\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0315305972:

Variant ID: vg0315305972 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 15305972
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:


CGCCTCCGGTACGAGGAAATGGCAATGGCACGCGGCACGGTAGCAGCGAAGATGAGGAGCGAACGACGACGGTCTTCTCCGGCTCCTACTTCAATGCAGC[A/G]
TCAGACCAACTTGCTCGCCTTTGGCCTCTGCGACGGCGCCGCCCCTATCGCCGGCGAGTTCGTCCGTCCCGCCTCGACACACCACCTCCGTCACCGGCGA

Reverse complement sequence

TCGCCGGTGACGGAGGTGGTGTGTCGAGGCGGGACGGACGAACTCGCCGGCGATAGGGGCGGCGCCGTCGCAGAGGCCAAAGGCGAGCAAGTTGGTCTGA[T/C]
GCTGCATTGAAGTAGGAGCCGGAGAAGACCGTCGTCGTTCGCTCCTCATCTTCGCTGCTACCGTGCCGCGTGCCATTGCCATTTCCTCGTACCGGAGGCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.50% 39.40% 0.06% 0.00% NA
All Indica  2759 86.00% 14.00% 0.04% 0.00% NA
All Japonica  1512 28.60% 71.40% 0.00% 0.00% NA
Aus  269 0.70% 99.30% 0.00% 0.00% NA
Indica I  595 92.40% 7.60% 0.00% 0.00% NA
Indica II  465 92.50% 7.50% 0.00% 0.00% NA
Indica III  913 79.30% 20.60% 0.11% 0.00% NA
Indica Intermediate  786 85.10% 14.90% 0.00% 0.00% NA
Temperate Japonica  767 6.90% 93.10% 0.00% 0.00% NA
Tropical Japonica  504 49.00% 51.00% 0.00% 0.00% NA
Japonica Intermediate  241 55.20% 44.80% 0.00% 0.00% NA
VI/Aromatic  96 9.40% 90.60% 0.00% 0.00% NA
Intermediate  90 48.90% 48.90% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0315305972 A -> G LOC_Os03g26820.1 upstream_gene_variant ; 1643.0bp to feature; MODIFIER silent_mutation Average:70.017; most accessible tissue: Callus, score: 82.384 N N N N
vg0315305972 A -> G LOC_Os03g26800.1 downstream_gene_variant ; 4816.0bp to feature; MODIFIER silent_mutation Average:70.017; most accessible tissue: Callus, score: 82.384 N N N N
vg0315305972 A -> G LOC_Os03g26810.1 downstream_gene_variant ; 524.0bp to feature; MODIFIER silent_mutation Average:70.017; most accessible tissue: Callus, score: 82.384 N N N N
vg0315305972 A -> G LOC_Os03g26810-LOC_Os03g26820 intergenic_region ; MODIFIER silent_mutation Average:70.017; most accessible tissue: Callus, score: 82.384 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0315305972 NA 1.81E-08 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315305972 NA 1.32E-13 mr1169 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315305972 NA 3.39E-20 mr1179 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315305972 NA 6.21E-08 mr1263 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315305972 NA 5.99E-11 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315305972 NA 6.21E-08 mr1451 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315305972 NA 3.12E-08 mr1465 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315305972 NA 5.82E-08 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315305972 NA 1.04E-09 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315305972 NA 3.17E-08 mr1836 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315305972 NA 5.30E-06 mr1871 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315305972 NA 1.25E-07 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315305972 NA 4.16E-08 mr1871_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251