\
| Variant ID: vg0315305972 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 15305972 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 120. )
CGCCTCCGGTACGAGGAAATGGCAATGGCACGCGGCACGGTAGCAGCGAAGATGAGGAGCGAACGACGACGGTCTTCTCCGGCTCCTACTTCAATGCAGC[A/G]
TCAGACCAACTTGCTCGCCTTTGGCCTCTGCGACGGCGCCGCCCCTATCGCCGGCGAGTTCGTCCGTCCCGCCTCGACACACCACCTCCGTCACCGGCGA
TCGCCGGTGACGGAGGTGGTGTGTCGAGGCGGGACGGACGAACTCGCCGGCGATAGGGGCGGCGCCGTCGCAGAGGCCAAAGGCGAGCAAGTTGGTCTGA[T/C]
GCTGCATTGAAGTAGGAGCCGGAGAAGACCGTCGTCGTTCGCTCCTCATCTTCGCTGCTACCGTGCCGCGTGCCATTGCCATTTCCTCGTACCGGAGGCG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.50% | 39.40% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 86.00% | 14.00% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 28.60% | 71.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 0.70% | 99.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 92.40% | 7.60% | 0.00% | 0.00% | NA |
| Indica II | 465 | 92.50% | 7.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 79.30% | 20.60% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 85.10% | 14.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 6.90% | 93.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 49.00% | 51.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 55.20% | 44.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 9.40% | 90.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 48.90% | 48.90% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0315305972 | A -> G | LOC_Os03g26820.1 | upstream_gene_variant ; 1643.0bp to feature; MODIFIER | silent_mutation | Average:70.017; most accessible tissue: Callus, score: 82.384 | N | N | N | N |
| vg0315305972 | A -> G | LOC_Os03g26800.1 | downstream_gene_variant ; 4816.0bp to feature; MODIFIER | silent_mutation | Average:70.017; most accessible tissue: Callus, score: 82.384 | N | N | N | N |
| vg0315305972 | A -> G | LOC_Os03g26810.1 | downstream_gene_variant ; 524.0bp to feature; MODIFIER | silent_mutation | Average:70.017; most accessible tissue: Callus, score: 82.384 | N | N | N | N |
| vg0315305972 | A -> G | LOC_Os03g26810-LOC_Os03g26820 | intergenic_region ; MODIFIER | silent_mutation | Average:70.017; most accessible tissue: Callus, score: 82.384 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0315305972 | NA | 1.81E-08 | mr1053 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315305972 | NA | 1.32E-13 | mr1169 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315305972 | NA | 3.39E-20 | mr1179 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315305972 | NA | 6.21E-08 | mr1263 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315305972 | NA | 5.99E-11 | mr1403 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315305972 | NA | 6.21E-08 | mr1451 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315305972 | NA | 3.12E-08 | mr1465 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315305972 | NA | 5.82E-08 | mr1763 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315305972 | NA | 1.04E-09 | mr1769 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315305972 | NA | 3.17E-08 | mr1836 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315305972 | NA | 5.30E-06 | mr1871 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315305972 | NA | 1.25E-07 | mr1498_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315305972 | NA | 4.16E-08 | mr1871_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |