\
| Variant ID: vg0315302142 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 15302142 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 254. )
TGTGTCAGCTAGTGATCAGTGTTTTCAAGCTGAAATGAATGGCATTGGATTGTTGCTGCTAATAAGTAAACGTGCCTTAGTTTTGGATAAAGAGACACGA[C/G]
TGCCACTGGTAGCCTAGCGCTTTTCTTACATCTTACATTAAAAAAAAACAGAACCAAACATGCTAGCAGCTGCAAACACATGCATCCAATCCCCAATCTG
CAGATTGGGGATTGGATGCATGTGTTTGCAGCTGCTAGCATGTTTGGTTCTGTTTTTTTTTAATGTAAGATGTAAGAAAAGCGCTAGGCTACCAGTGGCA[G/C]
TCGTGTCTCTTTATCCAAAACTAAGGCACGTTTACTTATTAGCAGCAACAATCCAATGCCATTCATTTCAGCTTGAAAACACTGATCACTAGCTGACACA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.50% | 39.40% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 85.90% | 14.00% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 28.60% | 71.30% | 0.07% | 0.00% | NA |
| Aus | 269 | 0.70% | 99.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 92.10% | 7.90% | 0.00% | 0.00% | NA |
| Indica II | 465 | 92.70% | 7.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 79.40% | 20.60% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 84.70% | 15.00% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 6.90% | 93.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 49.00% | 51.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 55.20% | 44.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 9.40% | 90.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 50.00% | 47.80% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0315302142 | C -> G | LOC_Os03g26791.1 | upstream_gene_variant ; 4235.0bp to feature; MODIFIER | silent_mutation | Average:65.248; most accessible tissue: Minghui63 root, score: 86.792 | N | N | N | N |
| vg0315302142 | C -> G | LOC_Os03g26810.1 | upstream_gene_variant ; 1655.0bp to feature; MODIFIER | silent_mutation | Average:65.248; most accessible tissue: Minghui63 root, score: 86.792 | N | N | N | N |
| vg0315302142 | C -> G | LOC_Os03g26800.1 | downstream_gene_variant ; 986.0bp to feature; MODIFIER | silent_mutation | Average:65.248; most accessible tissue: Minghui63 root, score: 86.792 | N | N | N | N |
| vg0315302142 | C -> G | LOC_Os03g26800-LOC_Os03g26810 | intergenic_region ; MODIFIER | silent_mutation | Average:65.248; most accessible tissue: Minghui63 root, score: 86.792 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0315302142 | NA | 2.24E-07 | mr1033 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315302142 | NA | 4.81E-09 | mr1045 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315302142 | NA | 1.69E-10 | mr1053 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315302142 | NA | 1.15E-06 | mr1058 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315302142 | NA | 8.42E-06 | mr1060 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315302142 | 6.56E-07 | NA | mr1083 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315302142 | 7.95E-06 | 4.43E-08 | mr1083 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315302142 | 5.96E-06 | NA | mr1085 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315302142 | NA | 7.01E-07 | mr1103 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315302142 | NA | 4.38E-06 | mr1104 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315302142 | 2.59E-06 | NA | mr1107 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315302142 | NA | 9.33E-07 | mr1107 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315302142 | 5.43E-06 | NA | mr1139 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315302142 | NA | 7.79E-06 | mr1139 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315302142 | NA | 2.31E-18 | mr1147 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315302142 | NA | 5.14E-07 | mr1157 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315302142 | NA | 3.21E-15 | mr1169 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315302142 | NA | 1.12E-06 | mr1176 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315302142 | NA | 7.76E-21 | mr1179 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315302142 | 2.71E-06 | NA | mr1226 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315302142 | NA | 8.62E-10 | mr1226 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315302142 | NA | 8.36E-12 | mr1233 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315302142 | NA | 7.60E-07 | mr1263 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315302142 | 5.32E-06 | 7.07E-25 | mr1264 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315302142 | NA | 1.42E-06 | mr1264 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315302142 | NA | 6.11E-06 | mr1312 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315302142 | NA | 1.50E-06 | mr1321 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315302142 | NA | 7.67E-11 | mr1403 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315302142 | 2.62E-08 | 2.76E-09 | mr1408 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315302142 | NA | 7.99E-09 | mr1408 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315302142 | 2.46E-07 | 1.07E-26 | mr1411 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315302142 | NA | 4.69E-10 | mr1411 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315302142 | NA | 9.24E-06 | mr1432 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315302142 | 5.41E-07 | NA | mr1437 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315302142 | NA | 1.11E-07 | mr1437 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315302142 | NA | 2.60E-06 | mr1437 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315302142 | NA | 8.16E-09 | mr1446 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315302142 | NA | 7.60E-07 | mr1451 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315302142 | NA | 7.32E-06 | mr1502 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315302142 | NA | 6.63E-12 | mr1540 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315302142 | NA | 2.52E-06 | mr1568 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315302142 | NA | 1.61E-06 | mr1614 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315302142 | NA | 3.96E-06 | mr1620 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315302142 | NA | 9.33E-07 | mr1621 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315302142 | NA | 7.07E-09 | mr1624 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315302142 | NA | 9.54E-07 | mr1717 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315302142 | NA | 4.00E-06 | mr1727 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315302142 | NA | 2.88E-06 | mr1729 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315302142 | NA | 1.22E-12 | mr1732 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315302142 | NA | 8.42E-10 | mr1763 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315302142 | NA | 2.47E-11 | mr1769 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315302142 | NA | 1.17E-07 | mr1836 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315302142 | NA | 2.65E-09 | mr1929 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315302142 | 9.19E-07 | 1.02E-12 | mr1949 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315302142 | NA | 5.61E-06 | mr1949 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315302142 | NA | 1.41E-07 | mr1989 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315302142 | NA | 6.50E-06 | mr1354_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315302142 | 6.76E-06 | NA | mr1437_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315302142 | NA | 5.04E-06 | mr1437_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |