\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0315270004:

Variant ID: vg0315270004 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 15270004
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.70, C: 0.30, others allele: 0.00, population size: 73. )

Flanking Sequence (100 bp) in Reference Genome:


CGCCTGCACGGCTAGCCTATTATGCCGTTGTTGTTGGGCGTCTACGTCTTCACCGACCGGCCGCCTCGTCCGCCGCCGACTGGTGTCTTCGCCTGCATGG[T/C]
TGGCCTATTCTGCCGCCGTTGTTGGGCGTCTACGTCTTCACCAATCGATCGCCTCGTCCGCCGCCGACTGGTGTTTCCTCCTGCATGGCTGGCCTATTAT

Reverse complement sequence

ATAATAGGCCAGCCATGCAGGAGGAAACACCAGTCGGCGGCGGACGAGGCGATCGATTGGTGAAGACGTAGACGCCCAACAACGGCGGCAGAATAGGCCA[A/G]
CCATGCAGGCGAAGACACCAGTCGGCGGCGGACGAGGCGGCCGGTCGGTGAAGACGTAGACGCCCAACAACAACGGCATAATAGGCTAGCCGTGCAGGCG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.00% 1.80% 2.69% 52.50% NA
All Indica  2759 31.80% 0.60% 3.55% 64.08% NA
All Japonica  1512 67.30% 2.70% 0.93% 29.03% NA
Aus  269 3.00% 9.30% 2.97% 84.76% NA
Indica I  595 55.60% 0.20% 2.52% 41.68% NA
Indica II  465 33.50% 0.00% 2.58% 63.87% NA
Indica III  913 14.30% 1.00% 4.93% 79.74% NA
Indica Intermediate  786 32.80% 0.90% 3.31% 62.98% NA
Temperate Japonica  767 94.30% 0.70% 0.65% 4.43% NA
Tropical Japonica  504 35.10% 3.00% 0.99% 60.91% NA
Japonica Intermediate  241 49.00% 8.70% 1.66% 40.66% NA
VI/Aromatic  96 86.50% 0.00% 3.12% 10.42% NA
Intermediate  90 52.20% 3.30% 4.44% 40.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0315270004 T -> C LOC_Os03g26750.1 downstream_gene_variant ; 3622.0bp to feature; MODIFIER silent_mutation Average:22.327; most accessible tissue: Minghui63 flag leaf, score: 42.823 N N N N
vg0315270004 T -> C LOC_Os03g26750-LOC_Os03g26760 intergenic_region ; MODIFIER silent_mutation Average:22.327; most accessible tissue: Minghui63 flag leaf, score: 42.823 N N N N
vg0315270004 T -> DEL N N silent_mutation Average:22.327; most accessible tissue: Minghui63 flag leaf, score: 42.823 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0315270004 NA 3.48E-07 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315270004 NA 8.08E-07 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315270004 3.88E-07 NA mr1088 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315270004 NA 3.82E-07 mr1088 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315270004 NA 1.53E-07 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315270004 NA 8.93E-07 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315270004 NA 5.24E-08 mr1139 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315270004 NA 1.68E-09 mr1226 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315270004 NA 6.01E-07 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315270004 NA 7.91E-07 mr1365 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315270004 NA 2.82E-09 mr1411 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315270004 NA 2.56E-07 mr1417 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315270004 NA 1.04E-07 mr1427 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315270004 NA 5.90E-08 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315270004 NA 2.44E-06 mr1634 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315270004 NA 2.02E-10 mr1696 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315270004 NA 1.31E-07 mr1762 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315270004 NA 5.84E-06 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315270004 7.71E-06 4.59E-10 mr1070_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315270004 6.68E-06 NA mr1083_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315270004 NA 8.27E-09 mr1088_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315270004 5.86E-06 NA mr1103_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315270004 NA 5.29E-06 mr1227_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315270004 NA 7.15E-06 mr1233_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315270004 NA 8.51E-07 mr1246_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315270004 NA 3.11E-07 mr1264_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315270004 NA 2.46E-06 mr1404_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315270004 NA 3.54E-09 mr1437_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315270004 NA 8.64E-09 mr1620_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315270004 NA 3.71E-06 mr1762_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315270004 NA 1.34E-06 mr1786_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315270004 NA 4.06E-06 mr1878_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251