\
| Variant ID: vg0315261472 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 15261472 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.54, C: 0.46, others allele: 0.00, population size: 78. )
TGCGTCGTGGGTTGGTCGAGAACAACATGAAGATCCTGGAGCTGCGACAGGAGAATCTGCAGCTGAAGAGGACCTAGACGCAGTGGAGGCGCAGCTGTGT[T/C]
AGCTCAAGATCGCCCAGGGAGAGGTCTGTCGCCCCAAGCGCCGCCGCGTCTGCCGCAGCCTGAAGATCACCGCCCGCAAGAGTACCTCCAGGCCCGAGCT
AGCTCGGGCCTGGAGGTACTCTTGCGGGCGGTGATCTTCAGGCTGCGGCAGACGCGGCGGCGCTTGGGGCGACAGACCTCTCCCTGGGCGATCTTGAGCT[A/G]
ACACAGCTGCGCCTCCACTGCGTCTAGGTCCTCTTCAGCTGCAGATTCTCCTGTCGCAGCTCCAGGATCTTCATGTTGTTCTCGACCAACCCACGACGCA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.80% | 29.90% | 9.86% | 0.42% | NA |
| All Indica | 2759 | 36.00% | 49.80% | 14.24% | 0.00% | NA |
| All Japonica | 1512 | 95.20% | 0.30% | 3.17% | 1.32% | NA |
| Aus | 269 | 84.00% | 8.90% | 7.06% | 0.00% | NA |
| Indica I | 595 | 58.20% | 30.40% | 11.43% | 0.00% | NA |
| Indica II | 465 | 34.60% | 53.10% | 12.26% | 0.00% | NA |
| Indica III | 913 | 18.30% | 62.90% | 18.84% | 0.00% | NA |
| Indica Intermediate | 786 | 40.60% | 47.20% | 12.21% | 0.00% | NA |
| Temperate Japonica | 767 | 97.00% | 0.30% | 1.56% | 1.17% | NA |
| Tropical Japonica | 504 | 96.40% | 0.20% | 2.98% | 0.40% | NA |
| Japonica Intermediate | 241 | 86.70% | 0.80% | 8.71% | 3.73% | NA |
| VI/Aromatic | 96 | 97.90% | 0.00% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 13.30% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0315261472 | T -> C | LOC_Os03g26750.1 | intron_variant ; MODIFIER | silent_mutation | Average:54.236; most accessible tissue: Minghui63 flag leaf, score: 80.241 | N | N | N | N |
| vg0315261472 | T -> DEL | N | N | silent_mutation | Average:54.236; most accessible tissue: Minghui63 flag leaf, score: 80.241 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0315261472 | NA | 2.13E-07 | mr1040 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315261472 | NA | 4.66E-22 | mr1077 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315261472 | NA | 8.81E-07 | mr1502 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315261472 | NA | 1.33E-20 | mr1541 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315261472 | NA | 2.81E-30 | mr1737 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315261472 | NA | 4.13E-06 | mr1780 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315261472 | NA | 4.85E-09 | mr1804 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315261472 | NA | 1.46E-14 | mr1982 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315261472 | NA | 2.39E-06 | mr1020_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315261472 | NA | 4.26E-07 | mr1422_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315261472 | NA | 4.06E-11 | mr1533_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315261472 | NA | 5.82E-06 | mr1583_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315261472 | NA | 1.27E-06 | mr1606_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |