Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0315257196:

Variant ID: vg0315257196 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 15257196
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.62, T: 0.38, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:

ATCTTCTCGGGGAAATCAATATTGACAAGAGGAGAAATACATATTTATAAACATTTTAAAATACTTGAATTTTTCTTGAGTATTATATTTACATCAGATA[T/C]
TACTCATCCTATATGTTTGTTCTGCAGGATCCAGATCTAGATATGCATAAAAGGGATTCATGGCTTTAAGCTTATCTCTTACGCTCCAGGAATGGATCAG

Reverse complement sequence

CTGATCCATTCCTGGAGCGTAAGAGATAAGCTTAAAGCCATGAATCCCTTTTATGCATATCTAGATCTGGATCCTGCAGAACAAACATATAGGATGAGTA[A/G]
TATCTGATGTAAATATAATACTCAAGAAAAATTCAAGTATTTTAAAATGTTTATAAATATGTATTTCTCCTCTTGTCAATATTGATTTCCCCGAGAAGAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	43.10%	11.10%	7.34%	38.51%	NA
All Indica	2759	32.20%	7.80%	3.33%	56.65%	NA
All Japonica	1512	67.10%	9.90%	8.00%	15.01%	NA
Aus	269	2.20%	52.40%	44.61%	0.74%	NA
Indica I	595	55.80%	3.50%	2.52%	38.15%	NA
Indica II	465	34.80%	6.70%	1.51%	56.99%	NA
Indica III	913	14.80%	10.70%	5.15%	69.33%	NA
Indica Intermediate	786	33.00%	8.40%	2.93%	55.73%	NA
Temperate Japonica	767	94.30%	0.40%	3.26%	2.09%	NA
Tropical Japonica	504	34.50%	26.80%	4.96%	33.73%	NA
Japonica Intermediate	241	49.00%	4.60%	29.46%	17.01%	NA
VI/Aromatic	96	86.50%	3.10%	5.21%	5.21%	NA
Intermediate	90	47.80%	16.70%	10.00%	25.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0315257196	T -> C	LOC_Os03g26750.1	upstream_gene_variant ; 2623.0bp to feature; MODIFIER	silent_mutation	Average:34.457; most accessible tissue: Minghui63 flag leaf, score: 59.244	N	N	N	N
vg0315257196	T -> C	LOC_Os03g26730.1	downstream_gene_variant ; 1033.0bp to feature; MODIFIER	silent_mutation	Average:34.457; most accessible tissue: Minghui63 flag leaf, score: 59.244	N	N	N	N
vg0315257196	T -> C	LOC_Os03g26730-LOC_Os03g26750	intergenic_region ; MODIFIER	silent_mutation	Average:34.457; most accessible tissue: Minghui63 flag leaf, score: 59.244	N	N	N	N
vg0315257196	T -> DEL	N	N	silent_mutation	Average:34.457; most accessible tissue: Minghui63 flag leaf, score: 59.244	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0315257196	NA	1.55E-06	mr1961	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315257196	NA	3.68E-06	mr1544_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315257196	NA	5.41E-08	mr1786_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251