\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0315257196:

Variant ID: vg0315257196 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 15257196
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.62, T: 0.38, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:


ATCTTCTCGGGGAAATCAATATTGACAAGAGGAGAAATACATATTTATAAACATTTTAAAATACTTGAATTTTTCTTGAGTATTATATTTACATCAGATA[T/C]
TACTCATCCTATATGTTTGTTCTGCAGGATCCAGATCTAGATATGCATAAAAGGGATTCATGGCTTTAAGCTTATCTCTTACGCTCCAGGAATGGATCAG

Reverse complement sequence

CTGATCCATTCCTGGAGCGTAAGAGATAAGCTTAAAGCCATGAATCCCTTTTATGCATATCTAGATCTGGATCCTGCAGAACAAACATATAGGATGAGTA[A/G]
TATCTGATGTAAATATAATACTCAAGAAAAATTCAAGTATTTTAAAATGTTTATAAATATGTATTTCTCCTCTTGTCAATATTGATTTCCCCGAGAAGAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.10% 11.10% 7.34% 38.51% NA
All Indica  2759 32.20% 7.80% 3.33% 56.65% NA
All Japonica  1512 67.10% 9.90% 8.00% 15.01% NA
Aus  269 2.20% 52.40% 44.61% 0.74% NA
Indica I  595 55.80% 3.50% 2.52% 38.15% NA
Indica II  465 34.80% 6.70% 1.51% 56.99% NA
Indica III  913 14.80% 10.70% 5.15% 69.33% NA
Indica Intermediate  786 33.00% 8.40% 2.93% 55.73% NA
Temperate Japonica  767 94.30% 0.40% 3.26% 2.09% NA
Tropical Japonica  504 34.50% 26.80% 4.96% 33.73% NA
Japonica Intermediate  241 49.00% 4.60% 29.46% 17.01% NA
VI/Aromatic  96 86.50% 3.10% 5.21% 5.21% NA
Intermediate  90 47.80% 16.70% 10.00% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0315257196 T -> C LOC_Os03g26750.1 upstream_gene_variant ; 2623.0bp to feature; MODIFIER silent_mutation Average:34.457; most accessible tissue: Minghui63 flag leaf, score: 59.244 N N N N
vg0315257196 T -> C LOC_Os03g26730.1 downstream_gene_variant ; 1033.0bp to feature; MODIFIER silent_mutation Average:34.457; most accessible tissue: Minghui63 flag leaf, score: 59.244 N N N N
vg0315257196 T -> C LOC_Os03g26730-LOC_Os03g26750 intergenic_region ; MODIFIER silent_mutation Average:34.457; most accessible tissue: Minghui63 flag leaf, score: 59.244 N N N N
vg0315257196 T -> DEL N N silent_mutation Average:34.457; most accessible tissue: Minghui63 flag leaf, score: 59.244 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0315257196 NA 1.55E-06 mr1961 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315257196 NA 3.68E-06 mr1544_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315257196 NA 5.41E-08 mr1786_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251