\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0315253958:

Variant ID: vg0315253958 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 15253958
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTAAATCCTTGTCTCCGCATCCATCCACTTTTAGGTCTCGTGCGCTACCCCTTTTATTATTGCCGAATTCATATTTCGACAGTTGGCGCGCCAGGTAGG[A/G]
GTGCGTCGAATTATCTGTCAAGAAGTGTGATGGAATCAACCTGAGTCGCCGGCATCATCCTCCCTCGAGTTTCATGGATTCTGCCGTCATCAACGCAATC

Reverse complement sequence

GATTGCGTTGATGACGGCAGAATCCATGAAACTCGAGGGAGGATGATGCCGGCGACTCAGGTTGATTCCATCACACTTCTTGACAGATAATTCGACGCAC[T/C]
CCTACCTGGCGCGCCAACTGTCGAAATATGAATTCGGCAATAATAAAAGGGGTAGCGCACGAGACCTAAAAGTGGATGGATGCGGAGACAAGGATTTAGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.20% 19.50% 3.81% 24.52% NA
All Indica  2759 34.30% 29.00% 3.59% 33.13% NA
All Japonica  1512 78.10% 6.20% 4.50% 11.18% NA
Aus  269 78.40% 1.90% 2.97% 16.73% NA
Indica I  595 53.10% 19.80% 3.03% 24.03% NA
Indica II  465 38.10% 16.30% 4.09% 41.51% NA
Indica III  913 20.30% 40.70% 2.96% 36.04% NA
Indica Intermediate  786 34.10% 29.80% 4.45% 31.68% NA
Temperate Japonica  767 96.30% 1.00% 1.17% 1.43% NA
Tropical Japonica  504 50.60% 12.50% 10.52% 26.39% NA
Japonica Intermediate  241 77.60% 9.50% 2.49% 10.37% NA
VI/Aromatic  96 78.10% 4.20% 1.04% 16.67% NA
Intermediate  90 58.90% 20.00% 4.44% 16.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0315253958 A -> DEL N N silent_mutation Average:41.47; most accessible tissue: Callus, score: 75.667 N N N N
vg0315253958 A -> G LOC_Os03g26704.1 upstream_gene_variant ; 4026.0bp to feature; MODIFIER silent_mutation Average:41.47; most accessible tissue: Callus, score: 75.667 N N N N
vg0315253958 A -> G LOC_Os03g26720.1 upstream_gene_variant ; 1935.0bp to feature; MODIFIER silent_mutation Average:41.47; most accessible tissue: Callus, score: 75.667 N N N N
vg0315253958 A -> G LOC_Os03g26730.1 upstream_gene_variant ; 1162.0bp to feature; MODIFIER silent_mutation Average:41.47; most accessible tissue: Callus, score: 75.667 N N N N
vg0315253958 A -> G LOC_Os03g26720-LOC_Os03g26730 intergenic_region ; MODIFIER silent_mutation Average:41.47; most accessible tissue: Callus, score: 75.667 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0315253958 2.32E-06 NA mr1280 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315253958 6.04E-07 NA mr1280 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315253958 2.15E-06 2.15E-06 mr1345 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315253958 9.70E-06 9.70E-06 mr1485 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315253958 8.77E-06 8.77E-06 mr1777 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251