\
| Variant ID: vg0315253958 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 15253958 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TCTAAATCCTTGTCTCCGCATCCATCCACTTTTAGGTCTCGTGCGCTACCCCTTTTATTATTGCCGAATTCATATTTCGACAGTTGGCGCGCCAGGTAGG[A/G]
GTGCGTCGAATTATCTGTCAAGAAGTGTGATGGAATCAACCTGAGTCGCCGGCATCATCCTCCCTCGAGTTTCATGGATTCTGCCGTCATCAACGCAATC
GATTGCGTTGATGACGGCAGAATCCATGAAACTCGAGGGAGGATGATGCCGGCGACTCAGGTTGATTCCATCACACTTCTTGACAGATAATTCGACGCAC[T/C]
CCTACCTGGCGCGCCAACTGTCGAAATATGAATTCGGCAATAATAAAAGGGGTAGCGCACGAGACCTAAAAGTGGATGGATGCGGAGACAAGGATTTAGA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.20% | 19.50% | 3.81% | 24.52% | NA |
| All Indica | 2759 | 34.30% | 29.00% | 3.59% | 33.13% | NA |
| All Japonica | 1512 | 78.10% | 6.20% | 4.50% | 11.18% | NA |
| Aus | 269 | 78.40% | 1.90% | 2.97% | 16.73% | NA |
| Indica I | 595 | 53.10% | 19.80% | 3.03% | 24.03% | NA |
| Indica II | 465 | 38.10% | 16.30% | 4.09% | 41.51% | NA |
| Indica III | 913 | 20.30% | 40.70% | 2.96% | 36.04% | NA |
| Indica Intermediate | 786 | 34.10% | 29.80% | 4.45% | 31.68% | NA |
| Temperate Japonica | 767 | 96.30% | 1.00% | 1.17% | 1.43% | NA |
| Tropical Japonica | 504 | 50.60% | 12.50% | 10.52% | 26.39% | NA |
| Japonica Intermediate | 241 | 77.60% | 9.50% | 2.49% | 10.37% | NA |
| VI/Aromatic | 96 | 78.10% | 4.20% | 1.04% | 16.67% | NA |
| Intermediate | 90 | 58.90% | 20.00% | 4.44% | 16.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0315253958 | A -> DEL | N | N | silent_mutation | Average:41.47; most accessible tissue: Callus, score: 75.667 | N | N | N | N |
| vg0315253958 | A -> G | LOC_Os03g26704.1 | upstream_gene_variant ; 4026.0bp to feature; MODIFIER | silent_mutation | Average:41.47; most accessible tissue: Callus, score: 75.667 | N | N | N | N |
| vg0315253958 | A -> G | LOC_Os03g26720.1 | upstream_gene_variant ; 1935.0bp to feature; MODIFIER | silent_mutation | Average:41.47; most accessible tissue: Callus, score: 75.667 | N | N | N | N |
| vg0315253958 | A -> G | LOC_Os03g26730.1 | upstream_gene_variant ; 1162.0bp to feature; MODIFIER | silent_mutation | Average:41.47; most accessible tissue: Callus, score: 75.667 | N | N | N | N |
| vg0315253958 | A -> G | LOC_Os03g26720-LOC_Os03g26730 | intergenic_region ; MODIFIER | silent_mutation | Average:41.47; most accessible tissue: Callus, score: 75.667 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0315253958 | 2.32E-06 | NA | mr1280 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315253958 | 6.04E-07 | NA | mr1280 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315253958 | 2.15E-06 | 2.15E-06 | mr1345 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315253958 | 9.70E-06 | 9.70E-06 | mr1485 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315253958 | 8.77E-06 | 8.77E-06 | mr1777 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |