\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0315250141:

Variant ID: vg0315250141 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 15250141
Reference Allele: CAlternative Allele: T,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTTGCCTTTTAGGTTCGTGAGCGTGCCAGTTGATTTAATCCTGCAATCAACAAGAAATAAAGATAAAGAAACCGTAGTTAATCCATAAATGATAGCCGAT[C/T,A]
GGCCAGCCGCCGATGACGTATCATTTGTACTCGAGCCGATGTCATCTTTGCATCGATCGGCTGTGCGAGGCAATAATATAGGAACTAAACCTATTCGATC

Reverse complement sequence

GATCGAATAGGTTTAGTTCCTATATTATTGCCTCGCACAGCCGATCGATGCAAAGATGACATCGGCTCGAGTACAAATGATACGTCATCGGCGGCTGGCC[G/A,T]
ATCGGCTATCATTTATGGATTAACTACGGTTTCTTTATCTTTATTTCTTGTTGATTGCAGGATTAAATCAACTGGCACGCTCACGAACCTAAAAGGCAAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.60% 3.00% 9.54% 21.65% A: 0.15%
All Indica  2759 50.20% 2.40% 11.56% 35.56% A: 0.25%
All Japonica  1512 95.50% 0.80% 1.72% 1.98% NA
Aus  269 39.40% 23.80% 36.80% 0.00% NA
Indica I  595 66.70% 2.20% 5.71% 25.04% A: 0.34%
Indica II  465 45.20% 0.90% 9.89% 43.66% A: 0.43%
Indica III  913 41.60% 2.70% 16.98% 38.44% A: 0.22%
Indica Intermediate  786 50.80% 3.10% 10.69% 35.37% A: 0.13%
Temperate Japonica  767 98.40% 0.00% 0.39% 1.17% NA
Tropical Japonica  504 93.10% 2.40% 3.77% 0.79% NA
Japonica Intermediate  241 91.30% 0.00% 1.66% 7.05% NA
VI/Aromatic  96 96.90% 0.00% 3.12% 0.00% NA
Intermediate  90 81.10% 1.10% 4.44% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0315250141 C -> T LOC_Os03g26704.1 upstream_gene_variant ; 209.0bp to feature; MODIFIER silent_mutation Average:10.926; most accessible tissue: Callus, score: 24.296 N N N N
vg0315250141 C -> T LOC_Os03g26730.1 upstream_gene_variant ; 4979.0bp to feature; MODIFIER silent_mutation Average:10.926; most accessible tissue: Callus, score: 24.296 N N N N
vg0315250141 C -> T LOC_Os03g26720.1 downstream_gene_variant ; 1343.0bp to feature; MODIFIER silent_mutation Average:10.926; most accessible tissue: Callus, score: 24.296 N N N N
vg0315250141 C -> T LOC_Os03g26704-LOC_Os03g26720 intergenic_region ; MODIFIER silent_mutation Average:10.926; most accessible tissue: Callus, score: 24.296 N N N N
vg0315250141 C -> A LOC_Os03g26704.1 upstream_gene_variant ; 209.0bp to feature; MODIFIER silent_mutation Average:10.926; most accessible tissue: Callus, score: 24.296 N N N N
vg0315250141 C -> A LOC_Os03g26730.1 upstream_gene_variant ; 4979.0bp to feature; MODIFIER silent_mutation Average:10.926; most accessible tissue: Callus, score: 24.296 N N N N
vg0315250141 C -> A LOC_Os03g26720.1 downstream_gene_variant ; 1343.0bp to feature; MODIFIER silent_mutation Average:10.926; most accessible tissue: Callus, score: 24.296 N N N N
vg0315250141 C -> A LOC_Os03g26704-LOC_Os03g26720 intergenic_region ; MODIFIER silent_mutation Average:10.926; most accessible tissue: Callus, score: 24.296 N N N N
vg0315250141 C -> DEL N N silent_mutation Average:10.926; most accessible tissue: Callus, score: 24.296 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0315250141 NA 5.20E-12 mr1017 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250141 NA 4.19E-12 mr1023 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250141 NA 2.38E-12 mr1055 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250141 NA 6.02E-12 mr1079 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250141 NA 1.52E-06 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250141 NA 2.35E-08 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250141 NA 1.04E-06 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250141 NA 1.49E-10 mr1132 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250141 NA 1.37E-07 mr1139 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250141 NA 1.03E-12 mr1142 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250141 NA 9.67E-06 mr1145 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250141 NA 1.01E-10 mr1226 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250141 NA 1.42E-11 mr1411 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250141 NA 1.06E-07 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250141 NA 1.03E-09 mr1489 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250141 NA 5.86E-11 mr1491 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250141 NA 7.84E-09 mr1546 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250141 NA 6.42E-07 mr1560 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250141 NA 1.94E-07 mr1805 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250141 NA 1.01E-10 mr1070_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250141 2.96E-08 NA mr1082_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250141 4.76E-07 NA mr1082_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250141 4.60E-07 NA mr1083_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250141 9.50E-07 NA mr1083_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250141 NA 5.70E-08 mr1088_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250141 NA 1.76E-06 mr1138_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250141 NA 3.95E-06 mr1246_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250141 NA 1.25E-07 mr1264_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250141 NA 6.29E-08 mr1354_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250141 NA 1.38E-06 mr1403_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250141 NA 5.22E-06 mr1404_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250141 2.86E-06 NA mr1437_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250141 4.55E-06 4.01E-11 mr1437_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250141 NA 1.27E-08 mr1620_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250141 6.07E-06 NA mr1878_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250141 NA 3.40E-06 mr1878_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251