Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0315250141:

Variant ID: vg0315250141 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 15250141
Reference Allele: C	Alternative Allele: T,A
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTTGCCTTTTAGGTTCGTGAGCGTGCCAGTTGATTTAATCCTGCAATCAACAAGAAATAAAGATAAAGAAACCGTAGTTAATCCATAAATGATAGCCGAT[C/T,A]
GGCCAGCCGCCGATGACGTATCATTTGTACTCGAGCCGATGTCATCTTTGCATCGATCGGCTGTGCGAGGCAATAATATAGGAACTAAACCTATTCGATC

Reverse complement sequence

GATCGAATAGGTTTAGTTCCTATATTATTGCCTCGCACAGCCGATCGATGCAAAGATGACATCGGCTCGAGTACAAATGATACGTCATCGGCGGCTGGCC[G/A,T]
ATCGGCTATCATTTATGGATTAACTACGGTTTCTTTATCTTTATTTCTTGTTGATTGCAGGATTAAATCAACTGGCACGCTCACGAACCTAAAAGGCAAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.60%	3.00%	9.54%	21.65%	A: 0.15%
All Indica	2759	50.20%	2.40%	11.56%	35.56%	A: 0.25%
All Japonica	1512	95.50%	0.80%	1.72%	1.98%	NA
Aus	269	39.40%	23.80%	36.80%	0.00%	NA
Indica I	595	66.70%	2.20%	5.71%	25.04%	A: 0.34%
Indica II	465	45.20%	0.90%	9.89%	43.66%	A: 0.43%
Indica III	913	41.60%	2.70%	16.98%	38.44%	A: 0.22%
Indica Intermediate	786	50.80%	3.10%	10.69%	35.37%	A: 0.13%
Temperate Japonica	767	98.40%	0.00%	0.39%	1.17%	NA
Tropical Japonica	504	93.10%	2.40%	3.77%	0.79%	NA
Japonica Intermediate	241	91.30%	0.00%	1.66%	7.05%	NA
VI/Aromatic	96	96.90%	0.00%	3.12%	0.00%	NA
Intermediate	90	81.10%	1.10%	4.44%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0315250141	C -> T	LOC_Os03g26704.1	upstream_gene_variant ; 209.0bp to feature; MODIFIER	silent_mutation	Average:10.926; most accessible tissue: Callus, score: 24.296	N	N	N	N
vg0315250141	C -> T	LOC_Os03g26730.1	upstream_gene_variant ; 4979.0bp to feature; MODIFIER	silent_mutation	Average:10.926; most accessible tissue: Callus, score: 24.296	N	N	N	N
vg0315250141	C -> T	LOC_Os03g26720.1	downstream_gene_variant ; 1343.0bp to feature; MODIFIER	silent_mutation	Average:10.926; most accessible tissue: Callus, score: 24.296	N	N	N	N
vg0315250141	C -> T	LOC_Os03g26704-LOC_Os03g26720	intergenic_region ; MODIFIER	silent_mutation	Average:10.926; most accessible tissue: Callus, score: 24.296	N	N	N	N
vg0315250141	C -> A	LOC_Os03g26704.1	upstream_gene_variant ; 209.0bp to feature; MODIFIER	silent_mutation	Average:10.926; most accessible tissue: Callus, score: 24.296	N	N	N	N
vg0315250141	C -> A	LOC_Os03g26730.1	upstream_gene_variant ; 4979.0bp to feature; MODIFIER	silent_mutation	Average:10.926; most accessible tissue: Callus, score: 24.296	N	N	N	N
vg0315250141	C -> A	LOC_Os03g26720.1	downstream_gene_variant ; 1343.0bp to feature; MODIFIER	silent_mutation	Average:10.926; most accessible tissue: Callus, score: 24.296	N	N	N	N
vg0315250141	C -> A	LOC_Os03g26704-LOC_Os03g26720	intergenic_region ; MODIFIER	silent_mutation	Average:10.926; most accessible tissue: Callus, score: 24.296	N	N	N	N
vg0315250141	C -> DEL	N	N	silent_mutation	Average:10.926; most accessible tissue: Callus, score: 24.296	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0315250141	NA	5.20E-12	mr1017	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250141	NA	4.19E-12	mr1023	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250141	NA	2.38E-12	mr1055	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250141	NA	6.02E-12	mr1079	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250141	NA	1.52E-06	mr1082	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250141	NA	2.35E-08	mr1103	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250141	NA	1.04E-06	mr1107	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250141	NA	1.49E-10	mr1132	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250141	NA	1.37E-07	mr1139	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250141	NA	1.03E-12	mr1142	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250141	NA	9.67E-06	mr1145	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250141	NA	1.01E-10	mr1226	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250141	NA	1.42E-11	mr1411	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250141	NA	1.06E-07	mr1437	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250141	NA	1.03E-09	mr1489	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250141	NA	5.86E-11	mr1491	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250141	NA	7.84E-09	mr1546	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250141	NA	6.42E-07	mr1560	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250141	NA	1.94E-07	mr1805	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250141	NA	1.01E-10	mr1070_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250141	2.96E-08	NA	mr1082_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250141	4.76E-07	NA	mr1082_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250141	4.60E-07	NA	mr1083_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250141	9.50E-07	NA	mr1083_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250141	NA	5.70E-08	mr1088_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250141	NA	1.76E-06	mr1138_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250141	NA	3.95E-06	mr1246_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250141	NA	1.25E-07	mr1264_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250141	NA	6.29E-08	mr1354_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250141	NA	1.38E-06	mr1403_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250141	NA	5.22E-06	mr1404_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250141	2.86E-06	NA	mr1437_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250141	4.55E-06	4.01E-11	mr1437_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250141	NA	1.27E-08	mr1620_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250141	6.07E-06	NA	mr1878_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315250141	NA	3.40E-06	mr1878_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251