Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0315247417:

Variant ID: vg0315247417 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 15247417
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:

TCCTTTGAACCCTTCTTTTCTGATTCTTGGTGAAAATACCCATAGGACACCATTGTGCTTTCCTATCTTCACCCTCATCATGGTCATAATCTTGATTCAC[C/T]
GGGCCCAACCTCTGATGAACAGGAACCCTTTTCTGACTCAGCCGATTACCTCTAGAATAGGATCGGCTCGAATTCCCTGCATTACTGCATCCAGGGCAAT

Reverse complement sequence

ATTGCCCTGGATGCAGTAATGCAGGGAATTCGAGCCGATCCTATTCTAGAGGTAATCGGCTGAGTCAGAAAAGGGTTCCTGTTCATCAGAGGTTGGGCCC[G/A]
GTGAATCAAGATTATGACCATGATGAGGGTGAAGATAGGAAAGCACAATGGTGTCCTATGGGTATTTTCACCAAGAATCAGAAAAGAAGGGTTCAAAGGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	49.70%	15.90%	5.31%	29.05%	NA
All Indica	2759	47.10%	11.80%	8.45%	32.66%	NA
All Japonica	1512	61.30%	21.40%	0.40%	16.93%	NA
Aus	269	5.60%	27.50%	3.72%	63.20%	NA
Indica I	595	50.60%	10.30%	3.03%	36.13%	NA
Indica II	465	41.30%	5.20%	8.39%	45.16%	NA
Indica III	913	48.60%	16.60%	12.38%	22.34%	NA
Indica Intermediate	786	46.20%	11.20%	8.02%	34.61%	NA
Temperate Japonica	767	88.30%	0.80%	0.13%	10.82%	NA
Tropical Japonica	504	22.80%	57.90%	0.60%	18.65%	NA
Japonica Intermediate	241	56.00%	10.40%	0.83%	32.78%	NA
VI/Aromatic	96	69.80%	7.30%	1.04%	21.88%	NA
Intermediate	90	45.60%	25.60%	1.11%	27.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0315247417	C -> T	LOC_Os03g26690.1	downstream_gene_variant ; 4583.0bp to feature; MODIFIER	silent_mutation	Average:7.045; most accessible tissue: Zhenshan97 young leaf, score: 17.571	N	N	N	N
vg0315247417	C -> T	LOC_Os03g26720.1	downstream_gene_variant ; 4067.0bp to feature; MODIFIER	silent_mutation	Average:7.045; most accessible tissue: Zhenshan97 young leaf, score: 17.571	N	N	N	N
vg0315247417	C -> T	LOC_Os03g26704.1	intron_variant ; MODIFIER	silent_mutation	Average:7.045; most accessible tissue: Zhenshan97 young leaf, score: 17.571	N	N	N	N
vg0315247417	C -> DEL	N	N	silent_mutation	Average:7.045; most accessible tissue: Zhenshan97 young leaf, score: 17.571	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0315247417	NA	3.89E-06	mr1104	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315247417	NA	5.18E-06	mr1213	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315247417	4.27E-06	3.32E-07	mr1350	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315247417	NA	1.67E-06	mr1692	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315247417	NA	2.79E-06	mr1509_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315247417	NA	1.19E-07	mr1558_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251