\
| Variant ID: vg0315247417 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 15247417 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 97. )
TCCTTTGAACCCTTCTTTTCTGATTCTTGGTGAAAATACCCATAGGACACCATTGTGCTTTCCTATCTTCACCCTCATCATGGTCATAATCTTGATTCAC[C/T]
GGGCCCAACCTCTGATGAACAGGAACCCTTTTCTGACTCAGCCGATTACCTCTAGAATAGGATCGGCTCGAATTCCCTGCATTACTGCATCCAGGGCAAT
ATTGCCCTGGATGCAGTAATGCAGGGAATTCGAGCCGATCCTATTCTAGAGGTAATCGGCTGAGTCAGAAAAGGGTTCCTGTTCATCAGAGGTTGGGCCC[G/A]
GTGAATCAAGATTATGACCATGATGAGGGTGAAGATAGGAAAGCACAATGGTGTCCTATGGGTATTTTCACCAAGAATCAGAAAAGAAGGGTTCAAAGGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.70% | 15.90% | 5.31% | 29.05% | NA |
| All Indica | 2759 | 47.10% | 11.80% | 8.45% | 32.66% | NA |
| All Japonica | 1512 | 61.30% | 21.40% | 0.40% | 16.93% | NA |
| Aus | 269 | 5.60% | 27.50% | 3.72% | 63.20% | NA |
| Indica I | 595 | 50.60% | 10.30% | 3.03% | 36.13% | NA |
| Indica II | 465 | 41.30% | 5.20% | 8.39% | 45.16% | NA |
| Indica III | 913 | 48.60% | 16.60% | 12.38% | 22.34% | NA |
| Indica Intermediate | 786 | 46.20% | 11.20% | 8.02% | 34.61% | NA |
| Temperate Japonica | 767 | 88.30% | 0.80% | 0.13% | 10.82% | NA |
| Tropical Japonica | 504 | 22.80% | 57.90% | 0.60% | 18.65% | NA |
| Japonica Intermediate | 241 | 56.00% | 10.40% | 0.83% | 32.78% | NA |
| VI/Aromatic | 96 | 69.80% | 7.30% | 1.04% | 21.88% | NA |
| Intermediate | 90 | 45.60% | 25.60% | 1.11% | 27.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0315247417 | C -> T | LOC_Os03g26690.1 | downstream_gene_variant ; 4583.0bp to feature; MODIFIER | silent_mutation | Average:7.045; most accessible tissue: Zhenshan97 young leaf, score: 17.571 | N | N | N | N |
| vg0315247417 | C -> T | LOC_Os03g26720.1 | downstream_gene_variant ; 4067.0bp to feature; MODIFIER | silent_mutation | Average:7.045; most accessible tissue: Zhenshan97 young leaf, score: 17.571 | N | N | N | N |
| vg0315247417 | C -> T | LOC_Os03g26704.1 | intron_variant ; MODIFIER | silent_mutation | Average:7.045; most accessible tissue: Zhenshan97 young leaf, score: 17.571 | N | N | N | N |
| vg0315247417 | C -> DEL | N | N | silent_mutation | Average:7.045; most accessible tissue: Zhenshan97 young leaf, score: 17.571 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0315247417 | NA | 3.89E-06 | mr1104 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315247417 | NA | 5.18E-06 | mr1213 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315247417 | 4.27E-06 | 3.32E-07 | mr1350 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315247417 | NA | 1.67E-06 | mr1692 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315247417 | NA | 2.79E-06 | mr1509_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315247417 | NA | 1.19E-07 | mr1558_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |