\
| Variant ID: vg0315246434 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 15246434 |
| Reference Allele: T | Alternative Allele: A,C |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.68, C: 0.32, others allele: 0.00, population size: 84. )
ATAAATGTCGGCCGTGGTCTGTCTCCCGGACCTATGTCAATTTCTTTCAAATCATCAGCCGACATGAAACCCTATCCTTGCTTGTCATCGAGATCATCTA[T/A,C]
TGTGTCCTTGTTGTAGACGTTTGAACCCTTCACAATGCCCTCAATGTAATAATTTGGGCTCTCCATCTTCAATTGGCTGTATATCACAATCGGACACTTT
AAAGTGTCCGATTGTGATATACAGCCAATTGAAGATGGAGAGCCCAAATTATTACATTGAGGGCATTGTGAAGGGTTCAAACGTCTACAACAAGGACACA[A/T,G]
TAGATGATCTCGATGACAAGCAAGGATAGGGTTTCATGTCGGCTGATGATTTGAAAGAAATTGACATAGGTCCGGGAGACAGACCACGGCCGACATTTAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 37.20% | 14.30% | 2.56% | 43.82% | C: 2.18% |
| All Indica | 2759 | 29.00% | 8.70% | 2.65% | 59.12% | C: 0.54% |
| All Japonica | 1512 | 56.00% | 22.00% | 2.58% | 14.09% | C: 5.42% |
| Aus | 269 | 2.20% | 27.50% | 2.23% | 67.29% | C: 0.74% |
| Indica I | 595 | 49.40% | 9.60% | 2.35% | 38.49% | C: 0.17% |
| Indica II | 465 | 33.30% | 4.50% | 1.72% | 60.22% | C: 0.22% |
| Indica III | 913 | 12.70% | 10.00% | 4.05% | 72.51% | C: 0.77% |
| Indica Intermediate | 786 | 30.00% | 8.90% | 1.78% | 58.52% | C: 0.76% |
| Temperate Japonica | 767 | 86.40% | 0.80% | 1.56% | 8.08% | C: 3.13% |
| Tropical Japonica | 504 | 19.80% | 59.50% | 3.17% | 14.88% | C: 2.58% |
| Japonica Intermediate | 241 | 34.40% | 10.80% | 4.56% | 31.54% | C: 18.67% |
| VI/Aromatic | 96 | 74.00% | 7.30% | 2.08% | 16.67% | NA |
| Intermediate | 90 | 35.60% | 25.60% | 1.11% | 33.33% | C: 4.44% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0315246434 | T -> C | LOC_Os03g26690.1 | downstream_gene_variant ; 3600.0bp to feature; MODIFIER | silent_mutation | Average:7.092; most accessible tissue: Callus, score: 27.553 | N | N | N | N |
| vg0315246434 | T -> C | LOC_Os03g26704.1 | intron_variant ; MODIFIER | silent_mutation | Average:7.092; most accessible tissue: Callus, score: 27.553 | N | N | N | N |
| vg0315246434 | T -> A | LOC_Os03g26690.1 | downstream_gene_variant ; 3600.0bp to feature; MODIFIER | silent_mutation | Average:7.092; most accessible tissue: Callus, score: 27.553 | N | N | N | N |
| vg0315246434 | T -> A | LOC_Os03g26704.1 | intron_variant ; MODIFIER | silent_mutation | Average:7.092; most accessible tissue: Callus, score: 27.553 | N | N | N | N |
| vg0315246434 | T -> DEL | N | N | silent_mutation | Average:7.092; most accessible tissue: Callus, score: 27.553 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0315246434 | 4.19E-07 | NA | mr1118_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315246434 | 3.48E-06 | NA | mr1607_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315246434 | 7.78E-07 | 1.58E-06 | mr1827_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315246434 | 7.44E-06 | NA | mr1904_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |