RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0315246434:

Variant ID: vg0315246434 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 15246434
Reference Allele: T	Alternative Allele: A,C
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.68, C: 0.32, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:

ATAAATGTCGGCCGTGGTCTGTCTCCCGGACCTATGTCAATTTCTTTCAAATCATCAGCCGACATGAAACCCTATCCTTGCTTGTCATCGAGATCATCTA[T/A,C]
TGTGTCCTTGTTGTAGACGTTTGAACCCTTCACAATGCCCTCAATGTAATAATTTGGGCTCTCCATCTTCAATTGGCTGTATATCACAATCGGACACTTT

Reverse complement sequence

AAAGTGTCCGATTGTGATATACAGCCAATTGAAGATGGAGAGCCCAAATTATTACATTGAGGGCATTGTGAAGGGTTCAAACGTCTACAACAAGGACACA[A/T,G]
TAGATGATCTCGATGACAAGCAAGGATAGGGTTTCATGTCGGCTGATGATTTGAAAGAAATTGACATAGGTCCGGGAGACAGACCACGGCCGACATTTAT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	37.20%	14.30%	2.56%	43.82%	C: 2.18%
All Indica	2759	29.00%	8.70%	2.65%	59.12%	C: 0.54%
All Japonica	1512	56.00%	22.00%	2.58%	14.09%	C: 5.42%
Aus	269	2.20%	27.50%	2.23%	67.29%	C: 0.74%
Indica I	595	49.40%	9.60%	2.35%	38.49%	C: 0.17%
Indica II	465	33.30%	4.50%	1.72%	60.22%	C: 0.22%
Indica III	913	12.70%	10.00%	4.05%	72.51%	C: 0.77%
Indica Intermediate	786	30.00%	8.90%	1.78%	58.52%	C: 0.76%
Temperate Japonica	767	86.40%	0.80%	1.56%	8.08%	C: 3.13%
Tropical Japonica	504	19.80%	59.50%	3.17%	14.88%	C: 2.58%
Japonica Intermediate	241	34.40%	10.80%	4.56%	31.54%	C: 18.67%
VI/Aromatic	96	74.00%	7.30%	2.08%	16.67%	NA
Intermediate	90	35.60%	25.60%	1.11%	33.33%	C: 4.44%

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0315246434	T -> C	LOC_Os03g26690.1	downstream_gene_variant ; 3600.0bp to feature; MODIFIER	silent_mutation	Average:7.092; most accessible tissue: Callus, score: 27.553	N	N	N	N
vg0315246434	T -> C	LOC_Os03g26704.1	intron_variant ; MODIFIER	silent_mutation	Average:7.092; most accessible tissue: Callus, score: 27.553	N	N	N	N
vg0315246434	T -> A	LOC_Os03g26690.1	downstream_gene_variant ; 3600.0bp to feature; MODIFIER	silent_mutation	Average:7.092; most accessible tissue: Callus, score: 27.553	N	N	N	N
vg0315246434	T -> A	LOC_Os03g26704.1	intron_variant ; MODIFIER	silent_mutation	Average:7.092; most accessible tissue: Callus, score: 27.553	N	N	N	N
vg0315246434	T -> DEL	N	N	silent_mutation	Average:7.092; most accessible tissue: Callus, score: 27.553	N	N	N	N

Showing 1 to 5 of 5 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0315246434	4.19E-07	NA	mr1118_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315246434	3.48E-06	NA	mr1607_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315246434	7.78E-07	1.58E-06	mr1827_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315246434	7.44E-06	NA	mr1904_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 4 of 4 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0315246434:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact