\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0315246434:

Variant ID: vg0315246434 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 15246434
Reference Allele: TAlternative Allele: A,C
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.68, C: 0.32, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:


ATAAATGTCGGCCGTGGTCTGTCTCCCGGACCTATGTCAATTTCTTTCAAATCATCAGCCGACATGAAACCCTATCCTTGCTTGTCATCGAGATCATCTA[T/A,C]
TGTGTCCTTGTTGTAGACGTTTGAACCCTTCACAATGCCCTCAATGTAATAATTTGGGCTCTCCATCTTCAATTGGCTGTATATCACAATCGGACACTTT

Reverse complement sequence

AAAGTGTCCGATTGTGATATACAGCCAATTGAAGATGGAGAGCCCAAATTATTACATTGAGGGCATTGTGAAGGGTTCAAACGTCTACAACAAGGACACA[A/T,G]
TAGATGATCTCGATGACAAGCAAGGATAGGGTTTCATGTCGGCTGATGATTTGAAAGAAATTGACATAGGTCCGGGAGACAGACCACGGCCGACATTTAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.20% 14.30% 2.56% 43.82% C: 2.18%
All Indica  2759 29.00% 8.70% 2.65% 59.12% C: 0.54%
All Japonica  1512 56.00% 22.00% 2.58% 14.09% C: 5.42%
Aus  269 2.20% 27.50% 2.23% 67.29% C: 0.74%
Indica I  595 49.40% 9.60% 2.35% 38.49% C: 0.17%
Indica II  465 33.30% 4.50% 1.72% 60.22% C: 0.22%
Indica III  913 12.70% 10.00% 4.05% 72.51% C: 0.77%
Indica Intermediate  786 30.00% 8.90% 1.78% 58.52% C: 0.76%
Temperate Japonica  767 86.40% 0.80% 1.56% 8.08% C: 3.13%
Tropical Japonica  504 19.80% 59.50% 3.17% 14.88% C: 2.58%
Japonica Intermediate  241 34.40% 10.80% 4.56% 31.54% C: 18.67%
VI/Aromatic  96 74.00% 7.30% 2.08% 16.67% NA
Intermediate  90 35.60% 25.60% 1.11% 33.33% C: 4.44%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0315246434 T -> C LOC_Os03g26690.1 downstream_gene_variant ; 3600.0bp to feature; MODIFIER silent_mutation Average:7.092; most accessible tissue: Callus, score: 27.553 N N N N
vg0315246434 T -> C LOC_Os03g26704.1 intron_variant ; MODIFIER silent_mutation Average:7.092; most accessible tissue: Callus, score: 27.553 N N N N
vg0315246434 T -> A LOC_Os03g26690.1 downstream_gene_variant ; 3600.0bp to feature; MODIFIER silent_mutation Average:7.092; most accessible tissue: Callus, score: 27.553 N N N N
vg0315246434 T -> A LOC_Os03g26704.1 intron_variant ; MODIFIER silent_mutation Average:7.092; most accessible tissue: Callus, score: 27.553 N N N N
vg0315246434 T -> DEL N N silent_mutation Average:7.092; most accessible tissue: Callus, score: 27.553 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0315246434 4.19E-07 NA mr1118_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315246434 3.48E-06 NA mr1607_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315246434 7.78E-07 1.58E-06 mr1827_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315246434 7.44E-06 NA mr1904_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251