Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0315238169:

Variant ID: vg0315238169 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 15238169
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:

CGATCTCTTCTCCGACCAAGCCTCTGCTCGCAGTGATGTCGACTTCCACTGGCCCGTCCGCTGCGCCATCAACCAGCCCGTCTGCTGCACCACCAGCCGA[G/A]
TATGCAGAGGTATGTATCCATCGGCTAGATGCCTTTTTCCTGTGTAGTAGATCGATTTTCTTCATCTCATCTTGTTTTCTTCTTCTCTACCTCTTTTGCA

Reverse complement sequence

TGCAAAAGAGGTAGAGAAGAAGAAAACAAGATGAGATGAAGAAAATCGATCTACTACACAGGAAAAAGGCATCTAGCCGATGGATACATACCTCTGCATA[C/T]
TCGGCTGGTGGTGCAGCAGACGGGCTGGTTGATGGCGCAGCGGACGGGCCAGTGGAAGTCGACATCACTGCGAGCAGAGGCTTGGTCGGAGAAGAGATCG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	47.40%	14.20%	5.08%	33.39%	NA
All Indica	2759	39.20%	8.60%	6.20%	45.96%	NA
All Japonica	1512	61.30%	22.60%	2.25%	13.89%	NA
Aus	269	42.80%	22.30%	11.15%	23.79%	NA
Indica I	595	35.60%	9.40%	5.55%	49.41%	NA
Indica II	465	18.50%	4.10%	8.39%	69.03%	NA
Indica III	913	55.00%	10.00%	6.35%	28.70%	NA
Indica Intermediate	786	35.90%	9.20%	5.22%	49.75%	NA
Temperate Japonica	767	89.70%	0.90%	1.04%	8.34%	NA
Tropical Japonica	504	23.20%	60.90%	3.37%	12.50%	NA
Japonica Intermediate	241	50.60%	11.20%	3.73%	34.44%	NA
VI/Aromatic	96	80.20%	7.30%	4.17%	8.33%	NA
Intermediate	90	41.10%	26.70%	1.11%	31.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0315238169	G -> A	LOC_Os03g26690.1	synonymous_variant ; p.Glu22Glu; LOW	synonymous_codon	Average:9.748; most accessible tissue: Callus, score: 34.301	N	N	N	N
vg0315238169	G -> DEL	LOC_Os03g26690.1	N	frameshift_variant	Average:9.748; most accessible tissue: Callus, score: 34.301	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0315238169	NA	1.88E-06	mr1029	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315238169	NA	6.74E-09	mr1047	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315238169	NA	1.59E-06	mr1189	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315238169	NA	1.05E-06	mr1543	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315238169	NA	1.18E-06	mr1625	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315238169	NA	2.40E-07	mr1642	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315238169	1.09E-06	NA	mr1042_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315238169	NA	4.91E-07	mr1042_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315238169	NA	3.41E-08	mr1047_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315238169	NA	5.33E-06	mr1269_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315238169	NA	1.86E-06	mr1291_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315238169	NA	4.60E-06	mr1363_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315238169	NA	2.53E-10	mr1471_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315238169	4.19E-06	4.06E-11	mr1502_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315238169	NA	1.14E-07	mr1502_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315238169	9.74E-06	1.87E-12	mr1543_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315238169	NA	2.47E-09	mr1543_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315238169	NA	4.99E-13	mr1642_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315238169	NA	6.07E-10	mr1642_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315238169	NA	4.38E-11	mr1680_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315238169	NA	7.30E-06	mr1704_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315238169	1.65E-07	2.76E-17	mr1742_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315238169	NA	4.90E-10	mr1742_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315238169	NA	6.36E-06	mr1786_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315238169	NA	1.20E-08	mr1808_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315238169	NA	2.31E-07	mr1808_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315238169	NA	8.27E-07	mr1815_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315238169	2.14E-06	NA	mr1871_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251