\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0315238169:

Variant ID: vg0315238169 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 15238169
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


CGATCTCTTCTCCGACCAAGCCTCTGCTCGCAGTGATGTCGACTTCCACTGGCCCGTCCGCTGCGCCATCAACCAGCCCGTCTGCTGCACCACCAGCCGA[G/A]
TATGCAGAGGTATGTATCCATCGGCTAGATGCCTTTTTCCTGTGTAGTAGATCGATTTTCTTCATCTCATCTTGTTTTCTTCTTCTCTACCTCTTTTGCA

Reverse complement sequence

TGCAAAAGAGGTAGAGAAGAAGAAAACAAGATGAGATGAAGAAAATCGATCTACTACACAGGAAAAAGGCATCTAGCCGATGGATACATACCTCTGCATA[C/T]
TCGGCTGGTGGTGCAGCAGACGGGCTGGTTGATGGCGCAGCGGACGGGCCAGTGGAAGTCGACATCACTGCGAGCAGAGGCTTGGTCGGAGAAGAGATCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.40% 14.20% 5.08% 33.39% NA
All Indica  2759 39.20% 8.60% 6.20% 45.96% NA
All Japonica  1512 61.30% 22.60% 2.25% 13.89% NA
Aus  269 42.80% 22.30% 11.15% 23.79% NA
Indica I  595 35.60% 9.40% 5.55% 49.41% NA
Indica II  465 18.50% 4.10% 8.39% 69.03% NA
Indica III  913 55.00% 10.00% 6.35% 28.70% NA
Indica Intermediate  786 35.90% 9.20% 5.22% 49.75% NA
Temperate Japonica  767 89.70% 0.90% 1.04% 8.34% NA
Tropical Japonica  504 23.20% 60.90% 3.37% 12.50% NA
Japonica Intermediate  241 50.60% 11.20% 3.73% 34.44% NA
VI/Aromatic  96 80.20% 7.30% 4.17% 8.33% NA
Intermediate  90 41.10% 26.70% 1.11% 31.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0315238169 G -> A LOC_Os03g26690.1 synonymous_variant ; p.Glu22Glu; LOW synonymous_codon Average:9.748; most accessible tissue: Callus, score: 34.301 N N N N
vg0315238169 G -> DEL LOC_Os03g26690.1 N frameshift_variant Average:9.748; most accessible tissue: Callus, score: 34.301 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0315238169 NA 1.88E-06 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315238169 NA 6.74E-09 mr1047 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315238169 NA 1.59E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315238169 NA 1.05E-06 mr1543 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315238169 NA 1.18E-06 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315238169 NA 2.40E-07 mr1642 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315238169 1.09E-06 NA mr1042_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315238169 NA 4.91E-07 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315238169 NA 3.41E-08 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315238169 NA 5.33E-06 mr1269_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315238169 NA 1.86E-06 mr1291_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315238169 NA 4.60E-06 mr1363_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315238169 NA 2.53E-10 mr1471_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315238169 4.19E-06 4.06E-11 mr1502_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315238169 NA 1.14E-07 mr1502_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315238169 9.74E-06 1.87E-12 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315238169 NA 2.47E-09 mr1543_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315238169 NA 4.99E-13 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315238169 NA 6.07E-10 mr1642_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315238169 NA 4.38E-11 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315238169 NA 7.30E-06 mr1704_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315238169 1.65E-07 2.76E-17 mr1742_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315238169 NA 4.90E-10 mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315238169 NA 6.36E-06 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315238169 NA 1.20E-08 mr1808_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315238169 NA 2.31E-07 mr1808_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315238169 NA 8.27E-07 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315238169 2.14E-06 NA mr1871_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251