Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0315225430:

Variant ID: vg0315225430 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 15225430
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, T: 0.02, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:

TCAATTTTAAATTCAGAGGTTTAAATTTGTACTAGCTTTAATTTTGGCTGTCTGAGCGCAGTGACCGAATGAGTTTGCTTGTTTTCGGTAGTTGATTCTA[G/T]
TCTAGAGTAAATTCCATAAAACTACAAGTATTTTAAGGAGATGACTAGGGATCGGACGTCCGATCCCAGTTAAAATTTCAGACAATGTTTCATCACATAA

Reverse complement sequence

TTATGTGATGAAACATTGTCTGAAATTTTAACTGGGATCGGACGTCCGATCCCTAGTCATCTCCTTAAAATACTTGTAGTTTTATGGAATTTACTCTAGA[C/A]
TAGAATCAACTACCGAAAACAAGCAAACTCATTCGGTCACTGCGCTCAGACAGCCAAAATTAAAGCTAGTACAAATTTAAACCTCTGAATTTAAAATTGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	39.60%	5.20%	0.76%	54.44%	NA
All Indica	2759	14.40%	3.70%	0.94%	80.94%	NA
All Japonica	1512	71.10%	8.90%	0.53%	19.44%	NA
Aus	269	98.50%	0.70%	0.00%	0.74%	NA
Indica I	595	15.60%	0.20%	2.02%	82.18%	NA
Indica II	465	3.90%	6.70%	1.29%	88.17%	NA
Indica III	913	17.00%	5.90%	0.11%	77.00%	NA
Indica Intermediate	786	16.70%	2.20%	0.89%	80.28%	NA
Temperate Japonica	767	96.10%	0.40%	0.00%	3.52%	NA
Tropical Japonica	504	31.90%	24.80%	1.59%	41.67%	NA
Japonica Intermediate	241	73.40%	2.90%	0.00%	23.65%	NA
VI/Aromatic	96	91.70%	0.00%	0.00%	8.33%	NA
Intermediate	90	51.10%	6.70%	2.22%	40.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0315225430	G -> T	LOC_Os03g26650.1	3_prime_UTR_variant ; 149.0bp to feature; MODIFIER	silent_mutation	Average:63.311; most accessible tissue: Callus, score: 85.167	N	N	N	N
vg0315225430	G -> T	LOC_Os03g26650.2	3_prime_UTR_variant ; 149.0bp to feature; MODIFIER	silent_mutation	Average:63.311; most accessible tissue: Callus, score: 85.167	N	N	N	N
vg0315225430	G -> T	LOC_Os03g26660.1	downstream_gene_variant ; 4503.0bp to feature; MODIFIER	silent_mutation	Average:63.311; most accessible tissue: Callus, score: 85.167	N	N	N	N
vg0315225430	G -> DEL	N	N	silent_mutation	Average:63.311; most accessible tissue: Callus, score: 85.167	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0315225430	NA	6.43E-13	mr1017	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315225430	NA	3.31E-12	mr1023	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315225430	NA	1.09E-12	mr1055	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315225430	NA	1.44E-06	mr1073	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315225430	NA	5.21E-12	mr1079	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315225430	NA	7.78E-06	mr1083	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315225430	NA	8.33E-09	mr1103	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315225430	NA	2.40E-08	mr1107	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315225430	NA	7.86E-11	mr1132	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315225430	NA	3.79E-07	mr1139	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315225430	NA	9.37E-13	mr1142	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315225430	NA	7.83E-07	mr1145	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315225430	NA	2.15E-11	mr1226	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315225430	NA	1.11E-11	mr1390	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315225430	NA	1.65E-06	mr1408	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315225430	NA	2.35E-12	mr1411	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315225430	NA	2.80E-08	mr1437	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315225430	NA	2.53E-09	mr1489	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315225430	NA	3.93E-10	mr1491	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315225430	NA	3.40E-09	mr1546	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315225430	NA	1.25E-07	mr1560	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315225430	NA	5.81E-07	mr1805	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315225430	NA	2.38E-06	mr1949	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315225430	3.79E-06	2.40E-11	mr1070_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315225430	1.08E-06	NA	mr1082_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315225430	1.13E-07	NA	mr1083_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315225430	4.69E-06	NA	mr1085_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315225430	NA	7.06E-09	mr1088_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315225430	7.55E-07	NA	mr1107_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315225430	NA	4.97E-06	mr1138_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315225430	NA	1.46E-07	mr1155_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315225430	6.40E-06	NA	mr1226_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315225430	NA	1.36E-06	mr1227_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315225430	NA	9.21E-07	mr1233_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315225430	NA	3.55E-06	mr1246_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315225430	NA	5.90E-08	mr1264_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315225430	NA	5.54E-09	mr1354_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315225430	NA	2.19E-07	mr1354_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315225430	NA	2.29E-07	mr1403_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315225430	NA	7.70E-07	mr1404_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315225430	2.61E-06	1.93E-11	mr1437_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315225430	2.68E-06	2.34E-09	mr1620_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315225430	NA	8.77E-07	mr1878_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315225430	7.78E-06	7.67E-09	mr1949_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251