\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0315182111:

Variant ID: vg0315182111 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 15182111
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.04, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:


AGCCTAGAATGCAAAGCTAGACACCTGTCTACATGAGCTGGGCTTCAAACGGAGCACCACCGAGCACGCGGTGTACACTCGTGGCGAGGGGACCAAGCGT[C/T]
TGATCGTTGGTGTCTACGTCGATGACCTCATCATCACCGGTGCACACGCTGAAGAAATTCGGCACTTCAAGGGAGAGATGCACTCTCTCTTCTGCATCAG

Reverse complement sequence

CTGATGCAGAAGAGAGAGTGCATCTCTCCCTTGAAGTGCCGAATTTCTTCAGCGTGTGCACCGGTGATGATGAGGTCATCGACGTAGACACCAACGATCA[G/A]
ACGCTTGGTCCCCTCGCCACGAGTGTACACCGCGTGCTCGGTGGTGCTCCGTTTGAAGCCCAGCTCATGTAGACAGGTGTCTAGCTTTGCATTCTAGGCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.50% 7.60% 0.70% 54.21% NA
All Indica  2759 11.40% 7.10% 0.72% 80.79% NA
All Japonica  1512 71.40% 8.90% 0.79% 18.92% NA
Aus  269 90.30% 8.90% 0.00% 0.74% NA
Indica I  595 12.80% 3.40% 1.01% 82.86% NA
Indica II  465 4.50% 6.70% 0.86% 87.96% NA
Indica III  913 11.60% 10.30% 0.44% 77.66% NA
Indica Intermediate  786 14.20% 6.40% 0.76% 78.63% NA
Temperate Japonica  767 96.20% 0.40% 0.26% 3.13% NA
Tropical Japonica  504 32.50% 24.60% 1.59% 41.27% NA
Japonica Intermediate  241 73.90% 2.90% 0.83% 22.41% NA
VI/Aromatic  96 91.70% 0.00% 0.00% 8.33% NA
Intermediate  90 50.00% 7.80% 1.11% 41.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0315182111 C -> T LOC_Os03g26570.1 synonymous_variant ; p.Leu840Leu; LOW synonymous_codon Average:41.765; most accessible tissue: Minghui63 young leaf, score: 79.549 N N N N
vg0315182111 C -> DEL LOC_Os03g26570.1 N frameshift_variant Average:41.765; most accessible tissue: Minghui63 young leaf, score: 79.549 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0315182111 NA 7.53E-11 mr1017 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315182111 NA 3.97E-10 mr1023 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315182111 NA 9.48E-06 mr1076 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315182111 NA 2.07E-06 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315182111 3.14E-06 NA mr1083 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315182111 2.99E-07 5.40E-10 mr1083 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315182111 NA 7.00E-09 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315182111 NA 5.03E-08 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315182111 NA 6.70E-08 mr1139 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315182111 NA 6.40E-11 mr1142 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315182111 NA 2.98E-06 mr1145 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315182111 NA 1.63E-12 mr1226 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315182111 NA 1.72E-08 mr1301 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315182111 NA 1.56E-06 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315182111 2.22E-06 4.06E-13 mr1411 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315182111 NA 1.32E-08 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315182111 NA 3.11E-08 mr1489 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315182111 NA 3.96E-10 mr1546 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315182111 NA 1.14E-06 mr1560 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315182111 NA 4.40E-06 mr1805 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315182111 NA 3.81E-10 mr1852 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315182111 NA 3.48E-06 mr1949 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315182111 NA 9.44E-06 mr1403_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251