\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0315179985:

Variant ID: vg0315179985 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 15179985
Reference Allele: CAlternative Allele: G,T
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, G: 0.01, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


CTGACCAATGGCGAGGTGCACCTGAACGAGGAACGCGTGCTCGTTTCTCTCTGTGACGAGGGGTAGCCGGTCGACCCCGACTGGATCCTTGACACGGGCG[C/G,T]
CTCCAACCACATGACTGGGGCGCGGGATGCCTTCTCCAACCTCGACACCACCGTGCACGGCACGGTCAAGTTCGGTGATGCCTCGCGCATGCGGATCGAG

Reverse complement sequence

CTCGATCCGCATGCGCGAGGCATCACCGAACTTGACCGTGCCGTGCACGGTGGTGTCGAGGTTGGAGAAGGCATCCCGCGCCCCAGTCATGTGGTTGGAG[G/C,A]
CGCCCGTGTCAAGGATCCAGTCGGGGTCGACCGGCTACCCCTCGTCACAGAGAGAAACGAGCACGCGTTCCTCGTTCAGGTGCACCTCGCCATTGGTCAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.20% 2.20% 1.84% 54.78% T: 0.02%
All Indica  2759 12.20% 3.70% 2.86% 81.30% NA
All Japonica  1512 79.70% 0.10% 0.33% 19.84% NA
Aus  269 99.30% 0.00% 0.00% 0.74% NA
Indica I  595 8.10% 0.00% 2.02% 89.92% NA
Indica II  465 4.10% 6.50% 2.58% 86.88% NA
Indica III  913 16.10% 6.00% 3.72% 74.15% NA
Indica Intermediate  786 15.50% 2.00% 2.67% 79.77% NA
Temperate Japonica  767 96.30% 0.10% 0.00% 3.52% NA
Tropical Japonica  504 56.20% 0.20% 0.79% 42.86% NA
Japonica Intermediate  241 75.90% 0.00% 0.41% 23.65% NA
VI/Aromatic  96 90.60% 0.00% 0.00% 8.33% T: 1.04%
Intermediate  90 55.60% 1.10% 3.33% 40.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0315179985 C -> T LOC_Os03g26570.1 missense_variant ; p.Ala220Val; MODERATE nonsynonymous_codon ; A220V Average:45.12; most accessible tissue: Minghui63 flag leaf, score: 77.828 benign 1.474 DELETERIOUS 0.03
vg0315179985 C -> DEL LOC_Os03g26570.1 N frameshift_variant Average:45.12; most accessible tissue: Minghui63 flag leaf, score: 77.828 N N N N
vg0315179985 C -> G LOC_Os03g26570.1 missense_variant ; p.Ala220Gly; MODERATE nonsynonymous_codon ; A220G Average:45.12; most accessible tissue: Minghui63 flag leaf, score: 77.828 benign 1.438 DELETERIOUS 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0315179985 NA 2.29E-11 mr1017 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315179985 NA 3.72E-12 mr1023 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315179985 NA 1.43E-12 mr1055 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315179985 NA 6.00E-12 mr1079 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315179985 NA 1.75E-06 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315179985 NA 1.20E-08 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315179985 NA 2.40E-07 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315179985 NA 1.20E-10 mr1132 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315179985 NA 2.62E-07 mr1139 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315179985 NA 3.12E-12 mr1142 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315179985 NA 2.76E-06 mr1145 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315179985 NA 2.18E-10 mr1226 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315179985 NA 2.79E-12 mr1411 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315179985 NA 4.65E-08 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315179985 NA 1.10E-09 mr1489 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315179985 NA 1.46E-10 mr1491 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315179985 NA 2.65E-07 mr1560 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315179985 NA 6.30E-07 mr1805 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315179985 NA 2.76E-06 mr1949 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315179985 NA 6.49E-11 mr1070_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315179985 3.05E-06 NA mr1082_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315179985 1.56E-06 NA mr1083_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315179985 NA 5.96E-11 mr1085_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315179985 NA 2.76E-08 mr1088_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315179985 NA 1.15E-06 mr1227_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315179985 NA 1.89E-07 mr1233_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315179985 NA 1.76E-06 mr1246_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315179985 NA 3.76E-07 mr1264_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315179985 NA 3.31E-07 mr1354_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315179985 NA 1.07E-06 mr1403_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315179985 NA 1.15E-06 mr1404_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315179985 NA 4.54E-11 mr1437_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315179985 NA 3.16E-08 mr1620_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315179985 NA 9.50E-07 mr1878_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315179985 NA 4.06E-09 mr1949_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251