\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0315128550:

Variant ID: vg0315128550 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 15128550
Reference Allele: CAlternative Allele: A,T
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.73, C: 0.28, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:


CATCATCGAGGCCCATGAGGCCCATGAGGGCTTGCTTCATAACATTAGTTCACCTATCGTCGCTCAACTTTACGTCGAGTCTTGTATGACATACCTAATC[C/A,T]
CCAAGACAAGAAGTATCAACTTCTTAATTGCTCAAACCATGCAAAGTAAGTCTCCTGGCAGTATGGATGCGTGGTTTCGCTGACGTAGCAAATCATCAGC

Reverse complement sequence

GCTGATGATTTGCTACGTCAGCGAAACCACGCATCCATACTGCCAGGAGACTTACTTTGCATGGTTTGAGCAATTAAGAAGTTGATACTTCTTGTCTTGG[G/T,A]
GATTAGGTATGTCATACAAGACTCGACGTAAAGTTGAGCGACGATAGGTGAACTAATGTTATGAAGCAAGCCCTCATGGGCCTCATGGGCCTCGATGATG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.70% 24.20% 0.00% 0.00% T: 0.06%
All Indica  2759 99.70% 0.30% 0.00% 0.00% T: 0.04%
All Japonica  1512 30.00% 70.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 99.50% 0.40% 0.00% 0.00% T: 0.13%
Temperate Japonica  767 3.90% 96.10% 0.00% 0.00% NA
Tropical Japonica  504 70.80% 29.20% 0.00% 0.00% NA
Japonica Intermediate  241 27.40% 72.60% 0.00% 0.00% NA
VI/Aromatic  96 39.60% 60.40% 0.00% 0.00% NA
Intermediate  90 74.40% 23.30% 0.00% 0.00% T: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0315128550 C -> T LOC_Os03g26490.1 upstream_gene_variant ; 301.0bp to feature; MODIFIER silent_mutation Average:93.322; most accessible tissue: Callus, score: 99.851 N N N N
vg0315128550 C -> T LOC_Os03g26480.1 downstream_gene_variant ; 1492.0bp to feature; MODIFIER silent_mutation Average:93.322; most accessible tissue: Callus, score: 99.851 N N N N
vg0315128550 C -> T LOC_Os03g26500.1 downstream_gene_variant ; 2838.0bp to feature; MODIFIER silent_mutation Average:93.322; most accessible tissue: Callus, score: 99.851 N N N N
vg0315128550 C -> T LOC_Os03g26490-LOC_Os03g26500 intergenic_region ; MODIFIER silent_mutation Average:93.322; most accessible tissue: Callus, score: 99.851 N N N N
vg0315128550 C -> A LOC_Os03g26490.1 upstream_gene_variant ; 301.0bp to feature; MODIFIER silent_mutation Average:93.322; most accessible tissue: Callus, score: 99.851 N N N N
vg0315128550 C -> A LOC_Os03g26480.1 downstream_gene_variant ; 1492.0bp to feature; MODIFIER silent_mutation Average:93.322; most accessible tissue: Callus, score: 99.851 N N N N
vg0315128550 C -> A LOC_Os03g26500.1 downstream_gene_variant ; 2838.0bp to feature; MODIFIER silent_mutation Average:93.322; most accessible tissue: Callus, score: 99.851 N N N N
vg0315128550 C -> A LOC_Os03g26490-LOC_Os03g26500 intergenic_region ; MODIFIER silent_mutation Average:93.322; most accessible tissue: Callus, score: 99.851 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0315128550 C A -0.02 -0.08 -0.07 -0.05 -0.05 -0.06
vg0315128550 C T -0.01 -0.01 -0.01 -0.02 -0.02 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0315128550 NA 2.15E-34 Grain_thickness All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0315128550 2.88E-07 6.59E-57 Grain_width All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0315128550 NA 1.06E-12 Grain_width Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0315128550 NA 6.90E-09 mr1248 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315128550 NA 2.36E-17 mr1308 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315128550 NA 1.37E-35 mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315128550 NA 1.74E-15 mr1401 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315128550 NA 8.51E-37 mr1533 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315128550 NA 1.77E-10 mr1575 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315128550 NA 2.51E-21 mr1584 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315128550 NA 3.13E-33 mr1733 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315128550 NA 4.42E-13 mr1741 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315128550 NA 2.81E-16 mr1830 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315128550 NA 4.11E-32 mr1980 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315128550 NA 6.64E-21 mr1308_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315128550 NA 4.14E-31 mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315128550 NA 1.19E-21 mr1361_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315128550 NA 4.93E-07 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315128550 NA 2.43E-38 mr1533_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315128550 NA 6.83E-17 mr1540_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315128550 NA 4.93E-07 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315128550 NA 2.68E-16 mr1732_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315128550 NA 1.65E-15 mr1790_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315128550 NA 3.72E-11 mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251