\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0315094287:

Variant ID: vg0315094287 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 15094287
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCGGATCTGGCCACCCAAGGTCCAAATCTGGCGTATCTTCAGCGAGGTATGGGCATCTCTCCAGCGCGAGAGGCTGGATCCCCTATTGCGGTGGTGGCGA[C/T]
GGCTGGCTGTGGTGGCGAAGGCACCGAGATGGATGACCGGATTTGGCCCCACAAGGTCTAGATCCGGCGCATCCACAAGGGGATCGGGCGAGACCGGCTC

Reverse complement sequence

GAGCCGGTCTCGCCCGATCCCCTTGTGGATGCGCCGGATCTAGACCTTGTGGGGCCAAATCCGGTCATCCATCTCGGTGCCTTCGCCACCACAGCCAGCC[G/A]
TCGCCACCACCGCAATAGGGGATCCAGCCTCTCGCGCTGGAGAGATGCCCATACCTCGCTGAAGATACGCCAGATTTGGACCTTGGGTGGCCAGATCCGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.00% 24.20% 0.36% 2.45% NA
All Indica  2759 99.20% 0.30% 0.14% 0.33% NA
All Japonica  1512 26.70% 69.80% 0.26% 3.24% NA
Aus  269 78.40% 0.00% 2.60% 18.96% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 99.60% 0.20% 0.11% 0.11% NA
Indica Intermediate  786 98.20% 0.40% 0.38% 1.02% NA
Temperate Japonica  767 3.80% 96.10% 0.00% 0.13% NA
Tropical Japonica  504 61.30% 28.80% 0.79% 9.13% NA
Japonica Intermediate  241 27.00% 72.20% 0.00% 0.83% NA
VI/Aromatic  96 39.60% 58.30% 0.00% 2.08% NA
Intermediate  90 65.60% 26.70% 2.22% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0315094287 C -> T LOC_Os03g26400.1 upstream_gene_variant ; 3069.0bp to feature; MODIFIER silent_mutation Average:85.812; most accessible tissue: Zhenshan97 young leaf, score: 91.311 N N N N
vg0315094287 C -> T LOC_Os03g26420.1 upstream_gene_variant ; 2830.0bp to feature; MODIFIER silent_mutation Average:85.812; most accessible tissue: Zhenshan97 young leaf, score: 91.311 N N N N
vg0315094287 C -> T LOC_Os03g26400-LOC_Os03g26420 intergenic_region ; MODIFIER silent_mutation Average:85.812; most accessible tissue: Zhenshan97 young leaf, score: 91.311 N N N N
vg0315094287 C -> DEL N N silent_mutation Average:85.812; most accessible tissue: Zhenshan97 young leaf, score: 91.311 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0315094287 C T 0.01 0.01 0.0 0.01 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0315094287 NA 2.84E-06 mr1121 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315094287 NA 9.15E-18 mr1308 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315094287 NA 2.76E-06 mr1422 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315094287 NA 3.51E-35 mr1533 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315094287 NA 1.76E-08 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315094287 NA 1.56E-11 mr1575 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315094287 NA 4.70E-07 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315094287 NA 7.98E-10 mr1712 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315094287 NA 4.31E-12 mr1741 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315094287 NA 1.95E-15 mr1830 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315094287 NA 8.15E-31 mr1980 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315094287 NA 3.33E-19 mr1156_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315094287 NA 4.01E-22 mr1304_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315094287 NA 1.33E-20 mr1308_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315094287 NA 3.33E-21 mr1361_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315094287 NA 2.56E-07 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315094287 NA 1.53E-37 mr1533_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315094287 NA 2.27E-11 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315094287 NA 1.09E-16 mr1539_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315094287 NA 2.79E-17 mr1540_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315094287 NA 6.16E-06 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315094287 NA 8.17E-17 mr1732_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315094287 NA 4.59E-14 mr1790_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315094287 NA 5.89E-12 mr1853_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315094287 NA 9.17E-18 mr1980_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251