Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0315044254:

Variant ID: vg0315044254 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 15044254
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.76, G: 0.23, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:

ATATTATTAAAATATATATTCAATATTAGATTTAATGAAACTAATTTCATATTTTACATGTTGCTAAGTTTTTCTATAAATTTGGTTGACTAGAAAAAAA[G/A]
TCAAATAATTTATAATATGAAACGGATGGAGTATTCAACTATTCATGTCTCATGCAACTATGCAAGTTTGTTGTACTGTCGAAAACAAATTAAATGAGAG

Reverse complement sequence

CTCTCATTTAATTTGTTTTCGACAGTACAACAAACTTGCATAGTTGCATGAGACATGAATAGTTGAATACTCCATCCGTTTCATATTATAAATTATTTGA[C/T]
TTTTTTTCTAGTCAACCAAATTTATAGAAAAACTTAGCAACATGTAAAATATGAAATTAGTTTCATTAAATCTAATATTGAATATATATTTTAATAATAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.20%	46.30%	0.47%	0.00%	NA
All Indica	2759	69.90%	29.60%	0.54%	0.00%	NA
All Japonica	1512	31.30%	68.40%	0.26%	0.00%	NA
Aus	269	14.90%	85.10%	0.00%	0.00%	NA
Indica I	595	45.00%	54.50%	0.50%	0.00%	NA
Indica II	465	50.50%	48.80%	0.65%	0.00%	NA
Indica III	913	89.90%	9.70%	0.33%	0.00%	NA
Indica Intermediate	786	76.80%	22.40%	0.76%	0.00%	NA
Temperate Japonica	767	10.80%	88.90%	0.26%	0.00%	NA
Tropical Japonica	504	51.80%	47.80%	0.40%	0.00%	NA
Japonica Intermediate	241	53.90%	46.10%	0.00%	0.00%	NA
VI/Aromatic	96	34.40%	65.60%	0.00%	0.00%	NA
Intermediate	90	45.60%	51.10%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0315044254	G -> A	LOC_Os03g26310.1	upstream_gene_variant ; 1856.0bp to feature; MODIFIER	silent_mutation	Average:37.831; most accessible tissue: Callus, score: 80.407	N	N	N	N
vg0315044254	G -> A	LOC_Os03g26329.1	upstream_gene_variant ; 1810.0bp to feature; MODIFIER	silent_mutation	Average:37.831; most accessible tissue: Callus, score: 80.407	N	N	N	N
vg0315044254	G -> A	LOC_Os03g26300.1	downstream_gene_variant ; 4398.0bp to feature; MODIFIER	silent_mutation	Average:37.831; most accessible tissue: Callus, score: 80.407	N	N	N	N
vg0315044254	G -> A	LOC_Os03g26310-LOC_Os03g26329	intergenic_region ; MODIFIER	silent_mutation	Average:37.831; most accessible tissue: Callus, score: 80.407	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0315044254	NA	9.81E-07	mr1045	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315044254	NA	1.10E-06	mr1157	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315044254	NA	1.64E-06	mr1179	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315044254	NA	2.39E-07	mr1236	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315044254	NA	1.45E-07	mr1237	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315044254	NA	8.24E-06	mr1263	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315044254	NA	8.24E-06	mr1451	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315044254	NA	7.42E-07	mr1526	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315044254	4.49E-06	4.49E-06	mr1572	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315044254	NA	6.85E-07	mr1729	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315044254	NA	1.46E-06	mr1844	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251