Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0315006527:

Variant ID: vg0315006527 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 15006527
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:

ATATCTTGGAGACGTTCGCTCATGATATGAGGATCAGTAGCTCTTGATATAAATTGACTGTTGTTTCAAACGTGGTTTTTTATTTGATGCCTTAGATTTT[C/T]
GTACATTTACCTGATACTCATGGTGTGTTGGGCTATACATGTCTAATTTCGCAATATTAATATTTCTCAGATGGCAAGACTTTCAAGAAACCAAGGCGTC

Reverse complement sequence

GACGCCTTGGTTTCTTGAAAGTCTTGCCATCTGAGAAATATTAATATTGCGAAATTAGACATGTATAGCCCAACACACCATGAGTATCAGGTAAATGTAC[G/A]
AAAATCTAAGGCATCAAATAAAAAACCACGTTTGAAACAACAGTCAATTTATATCAAGAGCTACTGATCCTCATATCATGAGCGAACGTCTCCAAGATAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.00%	26.70%	2.29%	1.04%	NA
All Indica	2759	70.90%	28.70%	0.40%	0.00%	NA
All Japonica	1512	79.30%	11.40%	6.08%	3.24%	NA
Aus	269	1.50%	97.80%	0.74%	0.00%	NA
Indica I	595	46.20%	53.60%	0.17%	0.00%	NA
Indica II	465	51.20%	48.40%	0.43%	0.00%	NA
Indica III	913	89.40%	10.50%	0.11%	0.00%	NA
Indica Intermediate	786	79.60%	19.50%	0.89%	0.00%	NA
Temperate Japonica	767	77.60%	6.00%	10.82%	5.61%	NA
Tropical Japonica	504	75.80%	22.20%	0.99%	0.99%	NA
Japonica Intermediate	241	92.10%	5.80%	1.66%	0.41%	NA
VI/Aromatic	96	92.70%	6.20%	1.04%	0.00%	NA
Intermediate	90	67.80%	30.00%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0315006527	C -> T	LOC_Os03g26220.1	upstream_gene_variant ; 1964.0bp to feature; MODIFIER	silent_mutation	Average:64.23; most accessible tissue: Callus, score: 82.42	N	N	N	N
vg0315006527	C -> T	LOC_Os03g26250.1	upstream_gene_variant ; 4635.0bp to feature; MODIFIER	silent_mutation	Average:64.23; most accessible tissue: Callus, score: 82.42	N	N	N	N
vg0315006527	C -> T	LOC_Os03g26210.1	downstream_gene_variant ; 4322.0bp to feature; MODIFIER	silent_mutation	Average:64.23; most accessible tissue: Callus, score: 82.42	N	N	N	N
vg0315006527	C -> T	LOC_Os03g26240.1	downstream_gene_variant ; 2228.0bp to feature; MODIFIER	silent_mutation	Average:64.23; most accessible tissue: Callus, score: 82.42	N	N	N	N
vg0315006527	C -> T	LOC_Os03g26210.3	downstream_gene_variant ; 4322.0bp to feature; MODIFIER	silent_mutation	Average:64.23; most accessible tissue: Callus, score: 82.42	N	N	N	N
vg0315006527	C -> T	LOC_Os03g26210.2	downstream_gene_variant ; 4322.0bp to feature; MODIFIER	silent_mutation	Average:64.23; most accessible tissue: Callus, score: 82.42	N	N	N	N
vg0315006527	C -> T	LOC_Os03g26229.1	intron_variant ; MODIFIER	silent_mutation	Average:64.23; most accessible tissue: Callus, score: 82.42	N	N	N	N
vg0315006527	C -> DEL	N	N	silent_mutation	Average:64.23; most accessible tissue: Callus, score: 82.42	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0315006527	NA	5.83E-09	mr1045	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006527	NA	1.17E-06	mr1072	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006527	NA	3.67E-07	mr1164	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006527	NA	1.20E-06	mr1179	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006527	NA	7.60E-07	mr1192	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006527	NA	1.21E-06	mr1202	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006527	NA	3.05E-06	mr1205	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006527	NA	6.47E-07	mr1236	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006527	NA	8.00E-06	mr1263	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006527	NA	1.35E-07	mr1280	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006527	NA	1.40E-06	mr1289	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006527	NA	2.29E-06	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006527	NA	2.21E-06	mr1359	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006527	6.58E-06	6.58E-06	mr1393	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006527	9.44E-06	9.44E-06	mr1412	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006527	NA	8.00E-06	mr1451	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006527	NA	8.40E-09	mr1521	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006527	1.64E-06	1.64E-06	mr1556	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006527	NA	1.80E-07	mr1576	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006527	NA	4.81E-06	mr1596	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006527	NA	1.22E-06	mr1668	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006527	4.31E-06	3.33E-07	mr1683	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006527	NA	3.54E-07	mr1723	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006527	1.74E-06	2.06E-11	mr1729	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006527	NA	1.58E-06	mr1741	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006527	NA	3.94E-07	mr1788	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006527	NA	2.82E-07	mr1844	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251