\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0315006527:

Variant ID: vg0315006527 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 15006527
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:


ATATCTTGGAGACGTTCGCTCATGATATGAGGATCAGTAGCTCTTGATATAAATTGACTGTTGTTTCAAACGTGGTTTTTTATTTGATGCCTTAGATTTT[C/T]
GTACATTTACCTGATACTCATGGTGTGTTGGGCTATACATGTCTAATTTCGCAATATTAATATTTCTCAGATGGCAAGACTTTCAAGAAACCAAGGCGTC

Reverse complement sequence

GACGCCTTGGTTTCTTGAAAGTCTTGCCATCTGAGAAATATTAATATTGCGAAATTAGACATGTATAGCCCAACACACCATGAGTATCAGGTAAATGTAC[G/A]
AAAATCTAAGGCATCAAATAAAAAACCACGTTTGAAACAACAGTCAATTTATATCAAGAGCTACTGATCCTCATATCATGAGCGAACGTCTCCAAGATAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.00% 26.70% 2.29% 1.04% NA
All Indica  2759 70.90% 28.70% 0.40% 0.00% NA
All Japonica  1512 79.30% 11.40% 6.08% 3.24% NA
Aus  269 1.50% 97.80% 0.74% 0.00% NA
Indica I  595 46.20% 53.60% 0.17% 0.00% NA
Indica II  465 51.20% 48.40% 0.43% 0.00% NA
Indica III  913 89.40% 10.50% 0.11% 0.00% NA
Indica Intermediate  786 79.60% 19.50% 0.89% 0.00% NA
Temperate Japonica  767 77.60% 6.00% 10.82% 5.61% NA
Tropical Japonica  504 75.80% 22.20% 0.99% 0.99% NA
Japonica Intermediate  241 92.10% 5.80% 1.66% 0.41% NA
VI/Aromatic  96 92.70% 6.20% 1.04% 0.00% NA
Intermediate  90 67.80% 30.00% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0315006527 C -> T LOC_Os03g26220.1 upstream_gene_variant ; 1964.0bp to feature; MODIFIER silent_mutation Average:64.23; most accessible tissue: Callus, score: 82.42 N N N N
vg0315006527 C -> T LOC_Os03g26250.1 upstream_gene_variant ; 4635.0bp to feature; MODIFIER silent_mutation Average:64.23; most accessible tissue: Callus, score: 82.42 N N N N
vg0315006527 C -> T LOC_Os03g26210.1 downstream_gene_variant ; 4322.0bp to feature; MODIFIER silent_mutation Average:64.23; most accessible tissue: Callus, score: 82.42 N N N N
vg0315006527 C -> T LOC_Os03g26240.1 downstream_gene_variant ; 2228.0bp to feature; MODIFIER silent_mutation Average:64.23; most accessible tissue: Callus, score: 82.42 N N N N
vg0315006527 C -> T LOC_Os03g26210.3 downstream_gene_variant ; 4322.0bp to feature; MODIFIER silent_mutation Average:64.23; most accessible tissue: Callus, score: 82.42 N N N N
vg0315006527 C -> T LOC_Os03g26210.2 downstream_gene_variant ; 4322.0bp to feature; MODIFIER silent_mutation Average:64.23; most accessible tissue: Callus, score: 82.42 N N N N
vg0315006527 C -> T LOC_Os03g26229.1 intron_variant ; MODIFIER silent_mutation Average:64.23; most accessible tissue: Callus, score: 82.42 N N N N
vg0315006527 C -> DEL N N silent_mutation Average:64.23; most accessible tissue: Callus, score: 82.42 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0315006527 NA 5.83E-09 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006527 NA 1.17E-06 mr1072 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006527 NA 3.67E-07 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006527 NA 1.20E-06 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006527 NA 7.60E-07 mr1192 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006527 NA 1.21E-06 mr1202 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006527 NA 3.05E-06 mr1205 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006527 NA 6.47E-07 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006527 NA 8.00E-06 mr1263 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006527 NA 1.35E-07 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006527 NA 1.40E-06 mr1289 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006527 NA 2.29E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006527 NA 2.21E-06 mr1359 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006527 6.58E-06 6.58E-06 mr1393 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006527 9.44E-06 9.44E-06 mr1412 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006527 NA 8.00E-06 mr1451 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006527 NA 8.40E-09 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006527 1.64E-06 1.64E-06 mr1556 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006527 NA 1.80E-07 mr1576 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006527 NA 4.81E-06 mr1596 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006527 NA 1.22E-06 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006527 4.31E-06 3.33E-07 mr1683 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006527 NA 3.54E-07 mr1723 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006527 1.74E-06 2.06E-11 mr1729 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006527 NA 1.58E-06 mr1741 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006527 NA 3.94E-07 mr1788 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315006527 NA 2.82E-07 mr1844 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251