| Variant ID: vg0315006527 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 15006527 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 200. )
ATATCTTGGAGACGTTCGCTCATGATATGAGGATCAGTAGCTCTTGATATAAATTGACTGTTGTTTCAAACGTGGTTTTTTATTTGATGCCTTAGATTTT[C/T]
GTACATTTACCTGATACTCATGGTGTGTTGGGCTATACATGTCTAATTTCGCAATATTAATATTTCTCAGATGGCAAGACTTTCAAGAAACCAAGGCGTC
GACGCCTTGGTTTCTTGAAAGTCTTGCCATCTGAGAAATATTAATATTGCGAAATTAGACATGTATAGCCCAACACACCATGAGTATCAGGTAAATGTAC[G/A]
AAAATCTAAGGCATCAAATAAAAAACCACGTTTGAAACAACAGTCAATTTATATCAAGAGCTACTGATCCTCATATCATGAGCGAACGTCTCCAAGATAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 70.00% | 26.70% | 2.29% | 1.04% | NA |
| All Indica | 2759 | 70.90% | 28.70% | 0.40% | 0.00% | NA |
| All Japonica | 1512 | 79.30% | 11.40% | 6.08% | 3.24% | NA |
| Aus | 269 | 1.50% | 97.80% | 0.74% | 0.00% | NA |
| Indica I | 595 | 46.20% | 53.60% | 0.17% | 0.00% | NA |
| Indica II | 465 | 51.20% | 48.40% | 0.43% | 0.00% | NA |
| Indica III | 913 | 89.40% | 10.50% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 79.60% | 19.50% | 0.89% | 0.00% | NA |
| Temperate Japonica | 767 | 77.60% | 6.00% | 10.82% | 5.61% | NA |
| Tropical Japonica | 504 | 75.80% | 22.20% | 0.99% | 0.99% | NA |
| Japonica Intermediate | 241 | 92.10% | 5.80% | 1.66% | 0.41% | NA |
| VI/Aromatic | 96 | 92.70% | 6.20% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 67.80% | 30.00% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0315006527 | C -> T | LOC_Os03g26220.1 | upstream_gene_variant ; 1964.0bp to feature; MODIFIER | silent_mutation | Average:64.23; most accessible tissue: Callus, score: 82.42 | N | N | N | N |
| vg0315006527 | C -> T | LOC_Os03g26250.1 | upstream_gene_variant ; 4635.0bp to feature; MODIFIER | silent_mutation | Average:64.23; most accessible tissue: Callus, score: 82.42 | N | N | N | N |
| vg0315006527 | C -> T | LOC_Os03g26210.1 | downstream_gene_variant ; 4322.0bp to feature; MODIFIER | silent_mutation | Average:64.23; most accessible tissue: Callus, score: 82.42 | N | N | N | N |
| vg0315006527 | C -> T | LOC_Os03g26240.1 | downstream_gene_variant ; 2228.0bp to feature; MODIFIER | silent_mutation | Average:64.23; most accessible tissue: Callus, score: 82.42 | N | N | N | N |
| vg0315006527 | C -> T | LOC_Os03g26210.3 | downstream_gene_variant ; 4322.0bp to feature; MODIFIER | silent_mutation | Average:64.23; most accessible tissue: Callus, score: 82.42 | N | N | N | N |
| vg0315006527 | C -> T | LOC_Os03g26210.2 | downstream_gene_variant ; 4322.0bp to feature; MODIFIER | silent_mutation | Average:64.23; most accessible tissue: Callus, score: 82.42 | N | N | N | N |
| vg0315006527 | C -> T | LOC_Os03g26229.1 | intron_variant ; MODIFIER | silent_mutation | Average:64.23; most accessible tissue: Callus, score: 82.42 | N | N | N | N |
| vg0315006527 | C -> DEL | N | N | silent_mutation | Average:64.23; most accessible tissue: Callus, score: 82.42 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0315006527 | NA | 5.83E-09 | mr1045 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315006527 | NA | 1.17E-06 | mr1072 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315006527 | NA | 3.67E-07 | mr1164 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315006527 | NA | 1.20E-06 | mr1179 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315006527 | NA | 7.60E-07 | mr1192 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315006527 | NA | 1.21E-06 | mr1202 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315006527 | NA | 3.05E-06 | mr1205 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315006527 | NA | 6.47E-07 | mr1236 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315006527 | NA | 8.00E-06 | mr1263 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315006527 | NA | 1.35E-07 | mr1280 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/