| Variant ID: vg0315006256 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 15006256 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 116. )
TGAATCTGGAGTCCGAGATCTCGTCATTTGAATCTGTTTTGGTAGTCCACGGGCAGATTAAGGGTCTTGCCTGATTTCACAAAGGTAACTGATTTGGTAC[A/G]
TTTGAGTCGTTTTGGTTAATCGGCTTGCTCGAGTTTGCCAGTTGTCAATAGTTCGTTTATGTGAATTAATAATCACAGTAGTCGTGCTTGACGTGGAAAT
ATTTCCACGTCAAGCACGACTACTGTGATTATTAATTCACATAAACGAACTATTGACAACTGGCAAACTCGAGCAAGCCGATTAACCAAAACGACTCAAA[T/C]
GTACCAAATCAGTTACCTTTGTGAAATCAGGCAAGACCCTTAATCTGCCCGTGGACTACCAAAACAGATTCAAATGACGAGATCTCGGACTCCAGATTCA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.10% | 41.50% | 0.40% | 0.00% | NA |
| All Indica | 2759 | 70.60% | 28.80% | 0.54% | 0.00% | NA |
| All Japonica | 1512 | 43.30% | 56.50% | 0.13% | 0.00% | NA |
| Aus | 269 | 1.50% | 98.10% | 0.37% | 0.00% | NA |
| Indica I | 595 | 46.10% | 53.60% | 0.34% | 0.00% | NA |
| Indica II | 465 | 50.80% | 48.40% | 0.86% | 0.00% | NA |
| Indica III | 913 | 89.20% | 10.60% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 79.50% | 19.60% | 0.89% | 0.00% | NA |
| Temperate Japonica | 767 | 17.50% | 82.40% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 64.30% | 35.50% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 81.70% | 18.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 91.70% | 7.30% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 57.80% | 42.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0315006256 | A -> G | LOC_Os03g26220.1 | upstream_gene_variant ; 1693.0bp to feature; MODIFIER | silent_mutation | Average:63.995; most accessible tissue: Callus, score: 83.362 | N | N | N | N |
| vg0315006256 | A -> G | LOC_Os03g26250.1 | upstream_gene_variant ; 4906.0bp to feature; MODIFIER | silent_mutation | Average:63.995; most accessible tissue: Callus, score: 83.362 | N | N | N | N |
| vg0315006256 | A -> G | LOC_Os03g26210.1 | downstream_gene_variant ; 4051.0bp to feature; MODIFIER | silent_mutation | Average:63.995; most accessible tissue: Callus, score: 83.362 | N | N | N | N |
| vg0315006256 | A -> G | LOC_Os03g26240.1 | downstream_gene_variant ; 2499.0bp to feature; MODIFIER | silent_mutation | Average:63.995; most accessible tissue: Callus, score: 83.362 | N | N | N | N |
| vg0315006256 | A -> G | LOC_Os03g26210.3 | downstream_gene_variant ; 4051.0bp to feature; MODIFIER | silent_mutation | Average:63.995; most accessible tissue: Callus, score: 83.362 | N | N | N | N |
| vg0315006256 | A -> G | LOC_Os03g26210.2 | downstream_gene_variant ; 4051.0bp to feature; MODIFIER | silent_mutation | Average:63.995; most accessible tissue: Callus, score: 83.362 | N | N | N | N |
| vg0315006256 | A -> G | LOC_Os03g26229.1 | intron_variant ; MODIFIER | silent_mutation | Average:63.995; most accessible tissue: Callus, score: 83.362 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0315006256 | 9.05E-06 | 9.05E-06 | mr1030 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315006256 | 2.81E-06 | 7.91E-10 | mr1045 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315006256 | 3.27E-06 | 3.27E-06 | mr1053 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315006256 | 3.89E-06 | 2.14E-07 | mr1072 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315006256 | NA | 4.66E-06 | mr1075 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315006256 | NA | 3.55E-06 | mr1077 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315006256 | NA | 5.11E-06 | mr1088 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315006256 | NA | 3.08E-07 | mr1164 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315006256 | 4.58E-06 | 4.58E-06 | mr1169 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315006256 | NA | 2.42E-06 | mr1170 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/