\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314998474:

Variant ID: vg0314998474 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 14998474
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCATAGTTTAATTTTTTTCTGGGACATAGTAGTATATGCTCATACCAAAATTTAAATCTTAAAACTTAATTTTAGAATTAATTTTAAGGTTTTTATTAT[G/A]
GCTTCTTTTTTTAATATCGGAGTTTAAATCATTAAAAACACATATGTAAAAGTTTTAACCATATATTATTTTTTTACGCTAATATGTCTTTTGGCGTATT

Reverse complement sequence

AATACGCCAAAAGACATATTAGCGTAAAAAAATAATATATGGTTAAAACTTTTACATATGTGTTTTTAATGATTTAAACTCCGATATTAAAAAAAGAAGC[C/T]
ATAATAAAAACCTTAAAATTAATTCTAAAATTAAGTTTTAAGATTTAAATTTTGGTATGAGCATATACTACTATGTCCCAGAAAAAAATTAAACTATGAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.20% 14.70% 0.04% 0.00% NA
All Indica  2759 99.90% 0.10% 0.00% 0.00% NA
All Japonica  1512 54.70% 45.20% 0.13% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 23.50% 76.30% 0.26% 0.00% NA
Tropical Japonica  504 86.70% 13.30% 0.00% 0.00% NA
Japonica Intermediate  241 87.10% 12.90% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 88.90% 11.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0314998474 G -> A LOC_Os03g26210.1 upstream_gene_variant ; 1588.0bp to feature; MODIFIER silent_mutation Average:41.662; most accessible tissue: Callus, score: 74.265 N N N N
vg0314998474 G -> A LOC_Os03g26210.3 upstream_gene_variant ; 1588.0bp to feature; MODIFIER silent_mutation Average:41.662; most accessible tissue: Callus, score: 74.265 N N N N
vg0314998474 G -> A LOC_Os03g26210.2 upstream_gene_variant ; 1589.0bp to feature; MODIFIER silent_mutation Average:41.662; most accessible tissue: Callus, score: 74.265 N N N N
vg0314998474 G -> A LOC_Os03g26200.1 downstream_gene_variant ; 1061.0bp to feature; MODIFIER silent_mutation Average:41.662; most accessible tissue: Callus, score: 74.265 N N N N
vg0314998474 G -> A LOC_Os03g26220.1 downstream_gene_variant ; 4044.0bp to feature; MODIFIER silent_mutation Average:41.662; most accessible tissue: Callus, score: 74.265 N N N N
vg0314998474 G -> A LOC_Os03g26200-LOC_Os03g26210 intergenic_region ; MODIFIER silent_mutation Average:41.662; most accessible tissue: Callus, score: 74.265 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0314998474 NA 2.04E-08 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314998474 NA 2.02E-07 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314998474 NA 9.09E-06 mr1072 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314998474 NA 5.56E-07 mr1077 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314998474 NA 7.06E-07 mr1202 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314998474 NA 4.44E-09 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314998474 NA 1.18E-06 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314998474 NA 4.84E-06 mr1530 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314998474 NA 2.25E-07 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314998474 NA 5.24E-06 mr1576 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314998474 NA 7.68E-07 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314998474 NA 1.37E-06 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314998474 1.36E-07 1.36E-07 mr1703 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314998474 6.25E-07 6.24E-07 mr1703 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314998474 NA 1.20E-06 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314998474 NA 1.85E-08 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314998474 NA 6.33E-06 mr1865 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314998474 NA 1.06E-06 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314998474 NA 2.07E-07 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314998474 NA 1.00E-05 mr1977 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314998474 NA 3.54E-13 mr1182_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314998474 NA 3.19E-06 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251