Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314998474:

Variant ID: vg0314998474 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 14998474
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTCATAGTTTAATTTTTTTCTGGGACATAGTAGTATATGCTCATACCAAAATTTAAATCTTAAAACTTAATTTTAGAATTAATTTTAAGGTTTTTATTAT[G/A]
GCTTCTTTTTTTAATATCGGAGTTTAAATCATTAAAAACACATATGTAAAAGTTTTAACCATATATTATTTTTTTACGCTAATATGTCTTTTGGCGTATT

Reverse complement sequence

AATACGCCAAAAGACATATTAGCGTAAAAAAATAATATATGGTTAAAACTTTTACATATGTGTTTTTAATGATTTAAACTCCGATATTAAAAAAAGAAGC[C/T]
ATAATAAAAACCTTAAAATTAATTCTAAAATTAAGTTTTAAGATTTAAATTTTGGTATGAGCATATACTACTATGTCCCAGAAAAAAATTAAACTATGAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.20%	14.70%	0.04%	0.00%	NA
All Indica	2759	99.90%	0.10%	0.00%	0.00%	NA
All Japonica	1512	54.70%	45.20%	0.13%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	100.00%	0.00%	0.00%	0.00%	NA
Temperate Japonica	767	23.50%	76.30%	0.26%	0.00%	NA
Tropical Japonica	504	86.70%	13.30%	0.00%	0.00%	NA
Japonica Intermediate	241	87.10%	12.90%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	88.90%	11.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0314998474	G -> A	LOC_Os03g26210.1	upstream_gene_variant ; 1588.0bp to feature; MODIFIER	silent_mutation	Average:41.662; most accessible tissue: Callus, score: 74.265	N	N	N	N
vg0314998474	G -> A	LOC_Os03g26210.3	upstream_gene_variant ; 1588.0bp to feature; MODIFIER	silent_mutation	Average:41.662; most accessible tissue: Callus, score: 74.265	N	N	N	N
vg0314998474	G -> A	LOC_Os03g26210.2	upstream_gene_variant ; 1589.0bp to feature; MODIFIER	silent_mutation	Average:41.662; most accessible tissue: Callus, score: 74.265	N	N	N	N
vg0314998474	G -> A	LOC_Os03g26200.1	downstream_gene_variant ; 1061.0bp to feature; MODIFIER	silent_mutation	Average:41.662; most accessible tissue: Callus, score: 74.265	N	N	N	N
vg0314998474	G -> A	LOC_Os03g26220.1	downstream_gene_variant ; 4044.0bp to feature; MODIFIER	silent_mutation	Average:41.662; most accessible tissue: Callus, score: 74.265	N	N	N	N
vg0314998474	G -> A	LOC_Os03g26200-LOC_Os03g26210	intergenic_region ; MODIFIER	silent_mutation	Average:41.662; most accessible tissue: Callus, score: 74.265	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0314998474	NA	2.04E-08	mr1045	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314998474	NA	2.02E-07	mr1045	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314998474	NA	9.09E-06	mr1072	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314998474	NA	5.56E-07	mr1077	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314998474	NA	7.06E-07	mr1202	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314998474	NA	4.44E-09	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314998474	NA	1.18E-06	mr1521	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314998474	NA	4.84E-06	mr1530	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314998474	NA	2.25E-07	mr1576	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314998474	NA	5.24E-06	mr1576	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314998474	NA	7.68E-07	mr1629	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314998474	NA	1.37E-06	mr1668	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314998474	1.36E-07	1.36E-07	mr1703	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314998474	6.25E-07	6.24E-07	mr1703	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314998474	NA	1.20E-06	mr1729	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314998474	NA	1.85E-08	mr1804	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314998474	NA	6.33E-06	mr1865	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314998474	NA	1.06E-06	mr1880	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314998474	NA	2.07E-07	mr1977	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314998474	NA	1.00E-05	mr1977	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314998474	NA	3.54E-13	mr1182_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314998474	NA	3.19E-06	mr1182_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251