Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314988402:

Variant ID: vg0314988402 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 14988402
Reference Allele: G	Alternative Allele: C
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.80, C: 0.21, others allele: 0.00, population size: 186. )

Flanking Sequence (100 bp) in Reference Genome:

CTTCTCATCATCTCTGGACACAAAAGTTTTGTCTCTACCAAATCCACAAAAACCAACACCTTCAGCTGCCGAAGAAGTTGCATTTTGTTCTGATGATGAT[G/C]
ATCATCATCAGCTCCGGTTGTGTATCGGGTCGGAGCCTCGCCGGACTCGCCACTTGCTCGTCTGCGCCGCGGCCGTCGTCGCCGCGAACCGCTCCTTCGC

Reverse complement sequence

GCGAAGGAGCGGTTCGCGGCGACGACGGCCGCGGCGCAGACGAGCAAGTGGCGAGTCCGGCGAGGCTCCGACCCGATACACAACCGGAGCTGATGATGAT[C/G]
ATCATCATCAGAACAAAATGCAACTTCTTCGGCAGCTGAAGGTGTTGGTTTTTGTGGATTTGGTAGAGACAAAACTTTTGTGTCCAGAGATGATGAGAAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.80%	34.80%	0.40%	0.00%	NA
All Indica	2759	69.60%	29.90%	0.54%	0.00%	NA
All Japonica	1512	70.20%	29.70%	0.13%	0.00%	NA
Aus	269	1.10%	98.90%	0.00%	0.00%	NA
Indica I	595	44.70%	54.60%	0.67%	0.00%	NA
Indica II	465	52.00%	47.70%	0.22%	0.00%	NA
Indica III	913	87.40%	12.20%	0.44%	0.00%	NA
Indica Intermediate	786	78.00%	21.20%	0.76%	0.00%	NA
Temperate Japonica	767	86.00%	14.00%	0.00%	0.00%	NA
Tropical Japonica	504	61.30%	38.30%	0.40%	0.00%	NA
Japonica Intermediate	241	38.20%	61.80%	0.00%	0.00%	NA
VI/Aromatic	96	35.40%	63.50%	1.04%	0.00%	NA
Intermediate	90	50.00%	48.90%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0314988402	G -> C	LOC_Os03g26200.1	upstream_gene_variant ; 4415.0bp to feature; MODIFIER	silent_mutation	Average:64.187; most accessible tissue: Zhenshan97 panicle, score: 78.302	N	N	N	N
vg0314988402	G -> C	LOC_Os03g26180.1	downstream_gene_variant ; 8.0bp to feature; MODIFIER	silent_mutation	Average:64.187; most accessible tissue: Zhenshan97 panicle, score: 78.302	N	N	N	N
vg0314988402	G -> C	LOC_Os03g26190.1	downstream_gene_variant ; 3905.0bp to feature; MODIFIER	silent_mutation	Average:64.187; most accessible tissue: Zhenshan97 panicle, score: 78.302	N	N	N	N
vg0314988402	G -> C	LOC_Os03g26130-LOC_Os03g26180	intergenic_region ; MODIFIER	silent_mutation	Average:64.187; most accessible tissue: Zhenshan97 panicle, score: 78.302	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0314988402	5.59E-06	5.59E-06	mr1994	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314988402	1.37E-06	1.37E-06	mr1041_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314988402	2.22E-06	2.22E-06	mr1293_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314988402	5.24E-06	5.24E-06	mr1294_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314988402	NA	4.53E-06	mr1556_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314988402	1.67E-06	1.67E-06	mr1604_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314988402	NA	9.43E-06	mr1759_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314988402	NA	8.24E-06	mr1764_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314988402	4.83E-06	4.83E-06	mr1840_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314988402	NA	6.64E-06	mr1894_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251