\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314986971:

Variant ID: vg0314986971 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 14986971
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATTTCGAATTTCAGTTACTTCTAAATTGTATTCCTATATTGACTTTAAACTATTCTTCCAATATTTTTCTTAATTTAGAATTTTAGTTATTTGTAAATT[A/G]
TATGTTTATACGGACTCTAAAATCTACTTTTAATTTTATTATGTTTATTCCAAATTTTAGTTAGTTTTAAATTTCAATATGGACTCTATACTCAACTTCT

Reverse complement sequence

AGAAGTTGAGTATAGAGTCCATATTGAAATTTAAAACTAACTAAAATTTGGAATAAACATAATAAAATTAAAAGTAGATTTTAGAGTCCGTATAAACATA[T/C]
AATTTACAAATAACTAAAATTCTAAATTAAGAAAAATATTGGAAGAATAGTTTAAAGTCAATATAGGAATACAATTTAGAAGTAACTGAAATTCGAAATT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.70% 11.70% 0.28% 0.32% NA
All Indica  2759 97.60% 1.70% 0.18% 0.43% NA
All Japonica  1512 71.20% 28.40% 0.20% 0.20% NA
Aus  269 99.30% 0.40% 0.37% 0.00% NA
Indica I  595 99.20% 0.70% 0.00% 0.17% NA
Indica II  465 98.50% 0.20% 0.43% 0.86% NA
Indica III  913 96.20% 3.30% 0.22% 0.33% NA
Indica Intermediate  786 97.70% 1.70% 0.13% 0.51% NA
Temperate Japonica  767 85.70% 13.70% 0.26% 0.39% NA
Tropical Japonica  504 64.30% 35.70% 0.00% 0.00% NA
Japonica Intermediate  241 39.40% 60.20% 0.41% 0.00% NA
VI/Aromatic  96 41.70% 57.30% 1.04% 0.00% NA
Intermediate  90 76.70% 20.00% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0314986971 A -> DEL N N silent_mutation Average:11.981; most accessible tissue: Zhenshan97 flower, score: 17.42 N N N N
vg0314986971 A -> G LOC_Os03g26180.1 downstream_gene_variant ; 1439.0bp to feature; MODIFIER silent_mutation Average:11.981; most accessible tissue: Zhenshan97 flower, score: 17.42 N N N N
vg0314986971 A -> G LOC_Os03g26130-LOC_Os03g26180 intergenic_region ; MODIFIER silent_mutation Average:11.981; most accessible tissue: Zhenshan97 flower, score: 17.42 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0314986971 NA 1.00E-06 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314986971 8.30E-07 8.30E-07 mr1041_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314986971 NA 3.84E-06 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314986971 NA 9.37E-06 mr1289_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314986971 NA 8.04E-06 mr1289_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314986971 2.34E-06 2.34E-06 mr1293_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314986971 5.22E-06 5.22E-06 mr1294_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314986971 7.91E-06 7.91E-06 mr1412_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314986971 NA 4.78E-07 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314986971 3.34E-06 3.33E-06 mr1418_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314986971 NA 3.49E-06 mr1467_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314986971 NA 1.75E-06 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314986971 NA 3.88E-06 mr1488_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314986971 6.07E-06 6.07E-06 mr1494_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314986971 NA 7.58E-06 mr1544_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314986971 NA 2.42E-06 mr1556_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314986971 NA 1.62E-06 mr1556_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314986971 3.07E-07 3.07E-07 mr1604_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314986971 9.57E-06 9.57E-06 mr1747_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314986971 NA 2.26E-06 mr1759_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314986971 NA 3.74E-06 mr1764_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314986971 NA 2.64E-06 mr1764_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314986971 NA 3.56E-06 mr1779_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314986971 NA 3.30E-06 mr1779_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314986971 8.91E-06 8.91E-06 mr1814_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314986971 4.76E-06 4.76E-06 mr1823_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314986971 2.68E-06 2.67E-06 mr1824_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314986971 2.87E-06 2.87E-06 mr1840_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314986971 NA 1.96E-06 mr1894_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314986971 NA 6.85E-07 mr1923_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251