\
| Variant ID: vg0314984758 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 14984758 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 103. )
TATAAGGGCACGTAATATATTCTATTAATATATAGTTAGAGATAATTGCAACATTATTTTTTTCTTTTCGAGCCTCGCTACGGTGCTTTCTACTAGTAGC[C/A]
GAAAACAATCTGAAGTGTTAATTTTATTTTATCGAAGGATTCCGATCTATTTATACTACCACCCCAGTTAGCGGTAGTAGAAATATGGAGATACATTATT
AATAATGTATCTCCATATTTCTACTACCGCTAACTGGGGTGGTAGTATAAATAGATCGGAATCCTTCGATAAAATAAAATTAACACTTCAGATTGTTTTC[G/T]
GCTACTAGTAGAAAGCACCGTAGCGAGGCTCGAAAAGAAAAAAATAATGTTGCAATTATCTCTAACTATATATTAATAGAATATATTACGTGCCCTTATA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.30% | 49.20% | 0.83% | 0.76% | NA |
| All Indica | 2759 | 27.60% | 70.20% | 1.05% | 1.16% | NA |
| All Japonica | 1512 | 78.20% | 21.20% | 0.53% | 0.07% | NA |
| Aus | 269 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 49.20% | 49.40% | 1.18% | 0.17% | NA |
| Indica II | 465 | 41.90% | 56.60% | 0.86% | 0.65% | NA |
| Indica III | 913 | 12.60% | 84.70% | 0.66% | 2.08% | NA |
| Indica Intermediate | 786 | 20.20% | 77.10% | 1.53% | 1.15% | NA |
| Temperate Japonica | 767 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 51.80% | 46.80% | 1.19% | 0.20% | NA |
| Japonica Intermediate | 241 | 75.50% | 23.70% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 65.60% | 33.30% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 61.10% | 34.40% | 2.22% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0314984758 | C -> A | LOC_Os03g26180.1 | downstream_gene_variant ; 3652.0bp to feature; MODIFIER | silent_mutation | Average:29.374; most accessible tissue: Callus, score: 53.856 | N | N | N | N |
| vg0314984758 | C -> A | LOC_Os03g26130-LOC_Os03g26180 | intergenic_region ; MODIFIER | silent_mutation | Average:29.374; most accessible tissue: Callus, score: 53.856 | N | N | N | N |
| vg0314984758 | C -> DEL | N | N | silent_mutation | Average:29.374; most accessible tissue: Callus, score: 53.856 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0314984758 | NA | 1.26E-14 | Grain_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0314984758 | NA | 7.94E-07 | mr1088 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314984758 | NA | 2.84E-06 | mr1104 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314984758 | NA | 1.50E-06 | mr1179 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314984758 | NA | 8.12E-06 | mr1213 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314984758 | NA | 5.59E-06 | mr1236 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314984758 | NA | 1.65E-06 | mr1437 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314984758 | NA | 3.36E-06 | mr1502 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314984758 | 4.24E-06 | 4.24E-06 | mr1578 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314984758 | NA | 3.06E-07 | mr1620 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314984758 | NA | 3.71E-06 | mr1634 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314984758 | NA | 8.42E-13 | mr1769 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314984758 | NA | 2.38E-07 | mr1422_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314984758 | NA | 7.00E-12 | mr1533_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314984758 | NA | 2.50E-06 | mr1583_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |