\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314984758:

Variant ID: vg0314984758 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 14984758
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


TATAAGGGCACGTAATATATTCTATTAATATATAGTTAGAGATAATTGCAACATTATTTTTTTCTTTTCGAGCCTCGCTACGGTGCTTTCTACTAGTAGC[C/A]
GAAAACAATCTGAAGTGTTAATTTTATTTTATCGAAGGATTCCGATCTATTTATACTACCACCCCAGTTAGCGGTAGTAGAAATATGGAGATACATTATT

Reverse complement sequence

AATAATGTATCTCCATATTTCTACTACCGCTAACTGGGGTGGTAGTATAAATAGATCGGAATCCTTCGATAAAATAAAATTAACACTTCAGATTGTTTTC[G/T]
GCTACTAGTAGAAAGCACCGTAGCGAGGCTCGAAAAGAAAAAAATAATGTTGCAATTATCTCTAACTATATATTAATAGAATATATTACGTGCCCTTATA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.30% 49.20% 0.83% 0.76% NA
All Indica  2759 27.60% 70.20% 1.05% 1.16% NA
All Japonica  1512 78.20% 21.20% 0.53% 0.07% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 49.20% 49.40% 1.18% 0.17% NA
Indica II  465 41.90% 56.60% 0.86% 0.65% NA
Indica III  913 12.60% 84.70% 0.66% 2.08% NA
Indica Intermediate  786 20.20% 77.10% 1.53% 1.15% NA
Temperate Japonica  767 96.30% 3.70% 0.00% 0.00% NA
Tropical Japonica  504 51.80% 46.80% 1.19% 0.20% NA
Japonica Intermediate  241 75.50% 23.70% 0.83% 0.00% NA
VI/Aromatic  96 65.60% 33.30% 0.00% 1.04% NA
Intermediate  90 61.10% 34.40% 2.22% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0314984758 C -> A LOC_Os03g26180.1 downstream_gene_variant ; 3652.0bp to feature; MODIFIER silent_mutation Average:29.374; most accessible tissue: Callus, score: 53.856 N N N N
vg0314984758 C -> A LOC_Os03g26130-LOC_Os03g26180 intergenic_region ; MODIFIER silent_mutation Average:29.374; most accessible tissue: Callus, score: 53.856 N N N N
vg0314984758 C -> DEL N N silent_mutation Average:29.374; most accessible tissue: Callus, score: 53.856 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0314984758 NA 1.26E-14 Grain_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0314984758 NA 7.94E-07 mr1088 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314984758 NA 2.84E-06 mr1104 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314984758 NA 1.50E-06 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314984758 NA 8.12E-06 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314984758 NA 5.59E-06 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314984758 NA 1.65E-06 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314984758 NA 3.36E-06 mr1502 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314984758 4.24E-06 4.24E-06 mr1578 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314984758 NA 3.06E-07 mr1620 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314984758 NA 3.71E-06 mr1634 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314984758 NA 8.42E-13 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314984758 NA 2.38E-07 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314984758 NA 7.00E-12 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314984758 NA 2.50E-06 mr1583_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251