| Variant ID: vg0314984669 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 14984669 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CAGCTGCGCCGCAGCCGGCACGAACAGTGCCGCACTCACTGTGCGCAGCCGCAGCCACGGCTGCAGCTATCGGCCTGCCGAACAGGCCCTATAAGGGCAC[G/A]
TAATATATTCTATTAATATATAGTTAGAGATAATTGCAACATTATTTTTTTCTTTTCGAGCCTCGCTACGGTGCTTTCTACTAGTAGCCGAAAACAATCT
AGATTGTTTTCGGCTACTAGTAGAAAGCACCGTAGCGAGGCTCGAAAAGAAAAAAATAATGTTGCAATTATCTCTAACTATATATTAATAGAATATATTA[C/T]
GTGCCCTTATAGGGCCTGTTCGGCAGGCCGATAGCTGCAGCCGTGGCTGCGGCTGCGCACAGTGAGTGCGGCACTGTTCGTGCCGGCTGCGGCGCAGCTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 36.90% | 15.80% | 7.79% | 39.46% | NA |
| All Indica | 2759 | 32.40% | 0.10% | 10.87% | 56.65% | NA |
| All Japonica | 1512 | 31.20% | 48.60% | 3.90% | 16.34% | NA |
| Aus | 269 | 98.90% | 0.00% | 0.00% | 1.12% | NA |
| Indica I | 595 | 50.80% | 0.00% | 11.76% | 37.48% | NA |
| Indica II | 465 | 46.00% | 0.20% | 7.96% | 45.81% | NA |
| Indica III | 913 | 19.40% | 0.20% | 11.28% | 69.11% | NA |
| Indica Intermediate | 786 | 25.40% | 0.00% | 11.45% | 63.10% | NA |
| Temperate Japonica | 767 | 14.20% | 82.50% | 0.78% | 2.48% | NA |
| Tropical Japonica | 504 | 40.90% | 13.50% | 8.93% | 36.71% | NA |
| Japonica Intermediate | 241 | 64.70% | 14.10% | 3.32% | 17.84% | NA |
| VI/Aromatic | 96 | 66.70% | 1.00% | 5.21% | 27.08% | NA |
| Intermediate | 90 | 55.60% | 11.10% | 4.44% | 28.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0314984669 | G -> A | LOC_Os03g26180.1 | downstream_gene_variant ; 3741.0bp to feature; MODIFIER | silent_mutation | Average:35.163; most accessible tissue: Minghui63 root, score: 59.105 | N | N | N | N |
| vg0314984669 | G -> A | LOC_Os03g26130-LOC_Os03g26180 | intergenic_region ; MODIFIER | silent_mutation | Average:35.163; most accessible tissue: Minghui63 root, score: 59.105 | N | N | N | N |
| vg0314984669 | G -> DEL | N | N | silent_mutation | Average:35.163; most accessible tissue: Minghui63 root, score: 59.105 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0314984669 | NA | 3.15E-10 | Heading_date | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0314984669 | NA | 6.09E-09 | mr1045 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314984669 | 9.36E-06 | 1.82E-08 | mr1045 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314984669 | NA | 1.30E-19 | mr1077 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314984669 | NA | 1.06E-07 | mr1077 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314984669 | NA | 9.65E-07 | mr1192 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314984669 | NA | 4.13E-07 | mr1202 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314984669 | NA | 5.10E-07 | mr1252 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314984669 | NA | 1.30E-06 | mr1252 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314984669 | NA | 3.33E-06 | mr1280 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/