Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0314971258:

Variant ID: vg0314971258 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 14971258
Reference Allele: C	Alternative Allele: G
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGTGAAAAAACCGGGAGTAAAAATACATCTTTAGTCCCGGTTGGTGTTACCAACTGGGACTAAAGATAGAGCCTTTTTAGTCCCGGTTGGTAAGATAGAG[C/G]
TAGCCTAGCTAGCTAGATCCGGTTGCTCTATTATTATTTTCTTTTCTTCATTGTGTTTTTAATATATTGATTTTACTCTATCCCCATCCAAAAATCCCAA

Reverse complement sequence

TTGGGATTTTTGGATGGGGATAGAGTAAAATCAATATATTAAAAACACAATGAAGAAAAGAAAATAATAATAGAGCAACCGGATCTAGCTAGCTAGGCTA[G/C]
CTCTATCTTACCAACCGGGACTAAAAAGGCTCTATCTTTAGTCCCAGTTGGTAACACCAACCGGGACTAAAGATGTATTTTTACTCCCGGTTTTTTCACC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	33.70%	16.00%	0.55%	49.70%	NA
All Indica	2759	28.00%	0.10%	0.83%	71.08%	NA
All Japonica	1512	29.40%	49.20%	0.20%	21.23%	NA
Aus	269	98.90%	0.00%	0.00%	1.12%	NA
Indica I	595	50.10%	0.00%	0.17%	49.75%	NA
Indica II	465	42.40%	0.20%	0.65%	56.77%	NA
Indica III	913	12.90%	0.10%	1.86%	85.10%	NA
Indica Intermediate	786	20.40%	0.00%	0.25%	79.39%	NA
Temperate Japonica	767	12.80%	83.70%	0.00%	3.52%	NA
Tropical Japonica	504	38.70%	13.70%	0.40%	47.22%	NA
Japonica Intermediate	241	62.70%	13.70%	0.41%	23.24%	NA
VI/Aromatic	96	65.60%	1.00%	0.00%	33.33%	NA
Intermediate	90	54.40%	10.00%	0.00%	35.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0314971258	C -> DEL	N	N	silent_mutation	Average:12.073; most accessible tissue: Minghui63 panicle, score: 25.313	N	N	N	N
vg0314971258	C -> G	LOC_Os03g26130.1	downstream_gene_variant ; 2736.0bp to feature; MODIFIER	silent_mutation	Average:12.073; most accessible tissue: Minghui63 panicle, score: 25.313	N	N	N	N
vg0314971258	C -> G	LOC_Os03g26130-LOC_Os03g26180	intergenic_region ; MODIFIER	silent_mutation	Average:12.073; most accessible tissue: Minghui63 panicle, score: 25.313	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0314971258	NA	7.75E-09	mr1045	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314971258	2.81E-06	1.42E-08	mr1045	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314971258	9.74E-06	5.19E-20	mr1077	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314971258	6.62E-06	6.36E-09	mr1077	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314971258	NA	3.94E-07	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314971258	NA	1.71E-06	mr1202	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314971258	NA	1.73E-08	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314971258	NA	1.55E-06	mr1359	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314971258	NA	3.08E-07	mr1448	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314971258	NA	1.59E-07	mr1521	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314971258	NA	1.36E-07	mr1576	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314971258	NA	1.80E-06	mr1576	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314971258	NA	1.17E-06	mr1627	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314971258	NA	1.84E-07	mr1629	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314971258	NA	2.16E-06	mr1668	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314971258	NA	4.30E-07	mr1671	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314971258	NA	3.08E-10	mr1712	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314971258	NA	1.09E-07	mr1729	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314971258	NA	4.31E-30	mr1789	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314971258	NA	4.14E-06	mr1837	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314971258	NA	1.30E-14	mr1844	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314971258	NA	2.45E-07	mr1844	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314971258	NA	1.27E-11	mr1879	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314971258	NA	3.87E-06	mr1977	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314971258	NA	7.70E-06	mr1793_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314971258	NA	5.24E-08	mr1952_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251