\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314970214:

Variant ID: vg0314970214 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 14970214
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.79, C: 0.21, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:


TGCAATTGTGCGTATAGAAGCGCACACTCTCTCCGTGAGAAATGCTTTTCCTAGAACTACACTGTGTAAAATTTCTCTAGTAAATTTTGTAGACAAGTCA[A/C]
CTGTAATATTCTTGTACTGTTTTTATTCATACATAATTATTTTATCATACATCTCGCTAATATGTTATTAAAATATATACATATATAAATAGCTTGTTGA

Reverse complement sequence

TCAACAAGCTATTTATATATGTATATATTTTAATAACATATTAGCGAGATGTATGATAAAATAATTATGTATGAATAAAAACAGTACAAGAATATTACAG[T/G]
TGACTTGTCTACAAAATTTACTAGAGAAATTTTACACAGTGTAGTTCTAGGAAAAGCATTTCTCACGGAGAGAGTGTGCGCTTCTATACGCACAATTGCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.80% 48.90% 0.17% 0.13% NA
All Indica  2759 72.60% 27.00% 0.22% 0.18% NA
All Japonica  1512 21.60% 78.30% 0.07% 0.00% NA
Aus  269 1.10% 98.90% 0.00% 0.00% NA
Indica I  595 50.40% 49.20% 0.17% 0.17% NA
Indica II  465 58.30% 41.50% 0.22% 0.00% NA
Indica III  913 87.80% 11.80% 0.33% 0.00% NA
Indica Intermediate  786 80.20% 19.20% 0.13% 0.51% NA
Temperate Japonica  767 3.50% 96.50% 0.00% 0.00% NA
Tropical Japonica  504 48.00% 51.80% 0.20% 0.00% NA
Japonica Intermediate  241 24.10% 75.90% 0.00% 0.00% NA
VI/Aromatic  96 34.40% 65.60% 0.00% 0.00% NA
Intermediate  90 36.70% 61.10% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0314970214 A -> C LOC_Os03g26130.1 downstream_gene_variant ; 1692.0bp to feature; MODIFIER silent_mutation Average:41.156; most accessible tissue: Callus, score: 68.466 N N N N
vg0314970214 A -> C LOC_Os03g26130-LOC_Os03g26180 intergenic_region ; MODIFIER silent_mutation Average:41.156; most accessible tissue: Callus, score: 68.466 N N N N
vg0314970214 A -> DEL N N silent_mutation Average:41.156; most accessible tissue: Callus, score: 68.466 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0314970214 NA 1.37E-07 mr1088 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314970214 NA 1.93E-07 mr1104 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314970214 NA 2.91E-06 mr1139 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314970214 NA 8.76E-06 mr1155 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314970214 NA 2.51E-06 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314970214 NA 1.18E-07 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314970214 NA 1.72E-06 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314970214 NA 6.61E-06 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314970214 NA 2.79E-06 mr1542 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314970214 6.20E-06 6.20E-06 mr1578 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314970214 NA 1.86E-08 mr1620 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314970214 NA 3.16E-08 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314970214 NA 1.12E-12 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314970214 NA 4.01E-07 mr1542_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314970214 NA 3.68E-07 mr1583_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314970214 NA 5.66E-06 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314970214 NA 1.73E-06 mr1873_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251