\
| Variant ID: vg0314970214 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 14970214 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.79, C: 0.21, others allele: 0.00, population size: 101. )
TGCAATTGTGCGTATAGAAGCGCACACTCTCTCCGTGAGAAATGCTTTTCCTAGAACTACACTGTGTAAAATTTCTCTAGTAAATTTTGTAGACAAGTCA[A/C]
CTGTAATATTCTTGTACTGTTTTTATTCATACATAATTATTTTATCATACATCTCGCTAATATGTTATTAAAATATATACATATATAAATAGCTTGTTGA
TCAACAAGCTATTTATATATGTATATATTTTAATAACATATTAGCGAGATGTATGATAAAATAATTATGTATGAATAAAAACAGTACAAGAATATTACAG[T/G]
TGACTTGTCTACAAAATTTACTAGAGAAATTTTACACAGTGTAGTTCTAGGAAAAGCATTTCTCACGGAGAGAGTGTGCGCTTCTATACGCACAATTGCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.80% | 48.90% | 0.17% | 0.13% | NA |
| All Indica | 2759 | 72.60% | 27.00% | 0.22% | 0.18% | NA |
| All Japonica | 1512 | 21.60% | 78.30% | 0.07% | 0.00% | NA |
| Aus | 269 | 1.10% | 98.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 50.40% | 49.20% | 0.17% | 0.17% | NA |
| Indica II | 465 | 58.30% | 41.50% | 0.22% | 0.00% | NA |
| Indica III | 913 | 87.80% | 11.80% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 80.20% | 19.20% | 0.13% | 0.51% | NA |
| Temperate Japonica | 767 | 3.50% | 96.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 48.00% | 51.80% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 24.10% | 75.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 34.40% | 65.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 36.70% | 61.10% | 1.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0314970214 | A -> C | LOC_Os03g26130.1 | downstream_gene_variant ; 1692.0bp to feature; MODIFIER | silent_mutation | Average:41.156; most accessible tissue: Callus, score: 68.466 | N | N | N | N |
| vg0314970214 | A -> C | LOC_Os03g26130-LOC_Os03g26180 | intergenic_region ; MODIFIER | silent_mutation | Average:41.156; most accessible tissue: Callus, score: 68.466 | N | N | N | N |
| vg0314970214 | A -> DEL | N | N | silent_mutation | Average:41.156; most accessible tissue: Callus, score: 68.466 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0314970214 | NA | 1.37E-07 | mr1088 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314970214 | NA | 1.93E-07 | mr1104 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314970214 | NA | 2.91E-06 | mr1139 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314970214 | NA | 8.76E-06 | mr1155 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314970214 | NA | 2.51E-06 | mr1156 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314970214 | NA | 1.18E-07 | mr1179 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314970214 | NA | 1.72E-06 | mr1213 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314970214 | NA | 6.61E-06 | mr1437 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314970214 | NA | 2.79E-06 | mr1542 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314970214 | 6.20E-06 | 6.20E-06 | mr1578 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314970214 | NA | 1.86E-08 | mr1620 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314970214 | NA | 3.16E-08 | mr1422_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314970214 | NA | 1.12E-12 | mr1533_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314970214 | NA | 4.01E-07 | mr1542_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314970214 | NA | 3.68E-07 | mr1583_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314970214 | NA | 5.66E-06 | mr1606_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314970214 | NA | 1.73E-06 | mr1873_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |