\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314969789:

Variant ID: vg0314969789 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 14969789
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


GAACACCACACCAACTGGGGGCCTCCAATGTGACGCAGGAGCTCCCATGCCATTAGATTATTTTGGTGTCACAGGAGCTCCCATGGATTGAGATCAGCTA[C/T]
AGTCGTAACTGCAGTTGATCTTGTCCATCCATTTTTTTGCACGAAGAATTCAGATCTATTGCGCTATAATAGCTCATCTATAGCAAATCCTTACCCTTAA

Reverse complement sequence

TTAAGGGTAAGGATTTGCTATAGATGAGCTATTATAGCGCAATAGATCTGAATTCTTCGTGCAAAAAAATGGATGGACAAGATCAACTGCAGTTACGACT[G/A]
TAGCTGATCTCAATCCATGGGAGCTCCTGTGACACCAAAATAATCTAATGGCATGGGAGCTCCTGCGTCACATTGGAGGCCCCCAGTTGGTGTGGTGTTC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.50% 44.10% 0.40% 0.00% NA
All Indica  2759 73.40% 26.30% 0.33% 0.00% NA
All Japonica  1512 22.20% 77.50% 0.26% 0.00% NA
Aus  269 70.60% 29.40% 0.00% 0.00% NA
Indica I  595 50.60% 49.10% 0.34% 0.00% NA
Indica II  465 58.30% 41.70% 0.00% 0.00% NA
Indica III  913 88.40% 11.40% 0.22% 0.00% NA
Indica Intermediate  786 82.20% 17.20% 0.64% 0.00% NA
Temperate Japonica  767 3.40% 96.50% 0.13% 0.00% NA
Tropical Japonica  504 50.00% 49.40% 0.60% 0.00% NA
Japonica Intermediate  241 24.10% 75.90% 0.00% 0.00% NA
VI/Aromatic  96 38.50% 59.40% 2.08% 0.00% NA
Intermediate  90 41.10% 54.40% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0314969789 C -> T LOC_Os03g26130.1 downstream_gene_variant ; 1267.0bp to feature; MODIFIER silent_mutation Average:58.62; most accessible tissue: Callus, score: 84.747 N N N N
vg0314969789 C -> T LOC_Os03g26130-LOC_Os03g26180 intergenic_region ; MODIFIER silent_mutation Average:58.62; most accessible tissue: Callus, score: 84.747 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0314969789 NA 7.94E-07 mr1088 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314969789 NA 2.84E-06 mr1104 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314969789 NA 2.73E-06 mr1125 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314969789 NA 3.01E-07 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314969789 NA 8.12E-06 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314969789 NA 8.13E-06 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314969789 NA 6.79E-06 mr1542 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314969789 NA 4.66E-08 mr1620 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314969789 NA 5.91E-14 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314969789 NA 4.28E-06 mr1221_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314969789 NA 2.81E-09 mr1422_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314969789 NA 1.10E-14 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314969789 NA 9.18E-07 mr1542_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314969789 NA 9.38E-08 mr1583_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314969789 NA 1.88E-07 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314969789 NA 2.64E-07 mr1873_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314969789 NA 5.26E-07 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314969789 NA 3.22E-10 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314969789 NA 3.94E-09 mr1942_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314969789 NA 3.34E-06 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251