\
| Variant ID: vg0314968998 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 14968998 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TGCCAGTGCGTTGCAACGGGTGAAGTCTATTTTAATCTTATTACTGTTATATGGTTTAGTTAAGATGAAGTTCACTGTGGGAGTTCGCTTGGATATATAT[T/A]
TTTTTGGAAAATAATGAGCTGCAGTTAGGAGTCCGATCGTTTTAAGTTAGCATGCGAGTTTTTTTTTATACAGATTTCTTATATGATTCCTTCTGTATTA
TAATACAGAAGGAATCATATAAGAAATCTGTATAAAAAAAAACTCGCATGCTAACTTAAAACGATCGGACTCCTAACTGCAGCTCATTATTTTCCAAAAA[A/T]
ATATATATCCAAGCGAACTCCCACAGTGAACTTCATCTTAACTAAACCATATAACAGTAATAAGATTAAAATAGACTTCACCCGTTGCAACGCACTGGCA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 32.80% | 16.80% | 0.85% | 49.62% | NA |
| All Indica | 2759 | 25.90% | 2.00% | 1.09% | 71.00% | NA |
| All Japonica | 1512 | 30.00% | 48.20% | 0.66% | 21.10% | NA |
| Aus | 269 | 98.90% | 0.00% | 0.00% | 1.12% | NA |
| Indica I | 595 | 49.10% | 0.00% | 0.34% | 50.59% | NA |
| Indica II | 465 | 41.10% | 0.60% | 0.86% | 57.42% | NA |
| Indica III | 913 | 7.70% | 5.50% | 2.30% | 84.56% | NA |
| Indica Intermediate | 786 | 20.60% | 0.30% | 0.38% | 78.75% | NA |
| Temperate Japonica | 767 | 14.00% | 81.90% | 0.65% | 3.52% | NA |
| Tropical Japonica | 504 | 38.70% | 13.70% | 0.79% | 46.83% | NA |
| Japonica Intermediate | 241 | 63.10% | 13.30% | 0.41% | 23.24% | NA |
| VI/Aromatic | 96 | 65.60% | 1.00% | 0.00% | 33.33% | NA |
| Intermediate | 90 | 55.60% | 8.90% | 0.00% | 35.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0314968998 | T -> A | LOC_Os03g26120.1 | upstream_gene_variant ; 4371.0bp to feature; MODIFIER | silent_mutation | Average:16.989; most accessible tissue: Callus, score: 72.758 | N | N | N | N |
| vg0314968998 | T -> A | LOC_Os03g26130.1 | downstream_gene_variant ; 476.0bp to feature; MODIFIER | silent_mutation | Average:16.989; most accessible tissue: Callus, score: 72.758 | N | N | N | N |
| vg0314968998 | T -> A | LOC_Os03g26130-LOC_Os03g26180 | intergenic_region ; MODIFIER | silent_mutation | Average:16.989; most accessible tissue: Callus, score: 72.758 | N | N | N | N |
| vg0314968998 | T -> DEL | N | N | silent_mutation | Average:16.989; most accessible tissue: Callus, score: 72.758 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0314968998 | NA | 3.83E-06 | mr1437 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314968998 | NA | 1.45E-06 | mr1542 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314968998 | NA | 8.38E-06 | mr1634 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314968998 | 7.98E-06 | 7.97E-06 | mr1041_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314968998 | 4.59E-06 | 4.59E-06 | mr1294_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314968998 | NA | 1.90E-07 | mr1542_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314968998 | NA | 3.59E-06 | mr1544_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314968998 | 4.61E-06 | 4.61E-06 | mr1604_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314968998 | 7.60E-06 | 7.59E-06 | mr1777_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |