\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314968998:

Variant ID: vg0314968998 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 14968998
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGCCAGTGCGTTGCAACGGGTGAAGTCTATTTTAATCTTATTACTGTTATATGGTTTAGTTAAGATGAAGTTCACTGTGGGAGTTCGCTTGGATATATAT[T/A]
TTTTTGGAAAATAATGAGCTGCAGTTAGGAGTCCGATCGTTTTAAGTTAGCATGCGAGTTTTTTTTTATACAGATTTCTTATATGATTCCTTCTGTATTA

Reverse complement sequence

TAATACAGAAGGAATCATATAAGAAATCTGTATAAAAAAAAACTCGCATGCTAACTTAAAACGATCGGACTCCTAACTGCAGCTCATTATTTTCCAAAAA[A/T]
ATATATATCCAAGCGAACTCCCACAGTGAACTTCATCTTAACTAAACCATATAACAGTAATAAGATTAAAATAGACTTCACCCGTTGCAACGCACTGGCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 32.80% 16.80% 0.85% 49.62% NA
All Indica  2759 25.90% 2.00% 1.09% 71.00% NA
All Japonica  1512 30.00% 48.20% 0.66% 21.10% NA
Aus  269 98.90% 0.00% 0.00% 1.12% NA
Indica I  595 49.10% 0.00% 0.34% 50.59% NA
Indica II  465 41.10% 0.60% 0.86% 57.42% NA
Indica III  913 7.70% 5.50% 2.30% 84.56% NA
Indica Intermediate  786 20.60% 0.30% 0.38% 78.75% NA
Temperate Japonica  767 14.00% 81.90% 0.65% 3.52% NA
Tropical Japonica  504 38.70% 13.70% 0.79% 46.83% NA
Japonica Intermediate  241 63.10% 13.30% 0.41% 23.24% NA
VI/Aromatic  96 65.60% 1.00% 0.00% 33.33% NA
Intermediate  90 55.60% 8.90% 0.00% 35.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0314968998 T -> A LOC_Os03g26120.1 upstream_gene_variant ; 4371.0bp to feature; MODIFIER silent_mutation Average:16.989; most accessible tissue: Callus, score: 72.758 N N N N
vg0314968998 T -> A LOC_Os03g26130.1 downstream_gene_variant ; 476.0bp to feature; MODIFIER silent_mutation Average:16.989; most accessible tissue: Callus, score: 72.758 N N N N
vg0314968998 T -> A LOC_Os03g26130-LOC_Os03g26180 intergenic_region ; MODIFIER silent_mutation Average:16.989; most accessible tissue: Callus, score: 72.758 N N N N
vg0314968998 T -> DEL N N silent_mutation Average:16.989; most accessible tissue: Callus, score: 72.758 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0314968998 NA 3.83E-06 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314968998 NA 1.45E-06 mr1542 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314968998 NA 8.38E-06 mr1634 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314968998 7.98E-06 7.97E-06 mr1041_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314968998 4.59E-06 4.59E-06 mr1294_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314968998 NA 1.90E-07 mr1542_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314968998 NA 3.59E-06 mr1544_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314968998 4.61E-06 4.61E-06 mr1604_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314968998 7.60E-06 7.59E-06 mr1777_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251