| Variant ID: vg0314967098 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 14967098 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 263. )
TTTTTTAAAAAAAATTCATAACTATTTGAATGTCATACAAGAAATAAAGAGACAACACGTGGATAGTTTAAAATCCATTCTCCTAAATAAATAATTCTGG[G/T]
TCACCATACAAAAACTAAATCTAATATGGATACCACTGTTGAAACAATTATGACGATCCAGCTAGTCAGCTCTAGGCTATATGTGCATACACACACATGC
GCATGTGTGTGTATGCACATATAGCCTAGAGCTGACTAGCTGGATCGTCATAATTGTTTCAACAGTGGTATCCATATTAGATTTAGTTTTTGTATGGTGA[C/A]
CCAGAATTATTTATTTAGGAGAATGGATTTTAAACTATCCACGTGTTGTCTCTTTATTTCTTGTATGACATTCAAATAGTTATGAATTTTTTTTAAAAAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.80% | 9.70% | 0.53% | 0.00% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 68.50% | 29.90% | 1.65% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 46.40% | 50.50% | 3.13% | 0.00% | NA |
| Tropical Japonica | 504 | 93.30% | 6.50% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 86.70% | 13.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0314967098 | G -> T | LOC_Os03g26120.1 | upstream_gene_variant ; 2471.0bp to feature; MODIFIER | silent_mutation | Average:69.404; most accessible tissue: Minghui63 root, score: 90.044 | N | N | N | N |
| vg0314967098 | G -> T | LOC_Os03g26130.1 | upstream_gene_variant ; 501.0bp to feature; MODIFIER | silent_mutation | Average:69.404; most accessible tissue: Minghui63 root, score: 90.044 | N | N | N | N |
| vg0314967098 | G -> T | LOC_Os03g26120-LOC_Os03g26130 | intergenic_region ; MODIFIER | silent_mutation | Average:69.404; most accessible tissue: Minghui63 root, score: 90.044 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0314967098 | NA | 2.34E-08 | mr1045 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314967098 | NA | 9.23E-07 | mr1045 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314967098 | NA | 1.38E-07 | mr1069 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314967098 | 8.82E-06 | NA | mr1072 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314967098 | 1.12E-06 | 3.73E-08 | mr1072 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314967098 | NA | 2.98E-07 | mr1077 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314967098 | NA | 3.19E-09 | mr1137 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314967098 | NA | 1.48E-07 | mr1149 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314967098 | NA | 3.64E-07 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314967098 | NA | 2.27E-06 | mr1164 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/