\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314931433:

Variant ID: vg0314931433 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 14931433
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


GCGGACAGCCATGTTTAGAAGGGCAATTTAATTTGATGATCTAGGGTGTCAAGCGTGTTGAGTATTTTAGATCTTTCAGTTGAGGCATTGAGCCATTGAA[T/C]
ATCTCGGGCATCATGTCCGTCGGTTTGTCCTCGATCTGGCGGTTGTGACACATGTGTAGTTTATGTTACAGTTAAAAAGAAAAGCCTTACGAGCCTATAG

Reverse complement sequence

CTATAGGCTCGTAAGGCTTTTCTTTTTAACTGTAACATAAACTACACATGTGTCACAACCGCCAGATCGAGGACAAACCGACGGACATGATGCCCGAGAT[A/G]
TTCAATGGCTCAATGCCTCAACTGAAAGATCTAAAATACTCAACACGCTTGACACCCTAGATCATCAAATTAAATTGCCCTTCTAAACATGGCTGTCCGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.50% 24.30% 0.13% 0.00% NA
All Indica  2759 98.70% 1.30% 0.00% 0.00% NA
All Japonica  1512 31.50% 68.10% 0.33% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 97.60% 2.40% 0.00% 0.00% NA
Indica Intermediate  786 98.30% 1.70% 0.00% 0.00% NA
Temperate Japonica  767 9.90% 89.40% 0.65% 0.00% NA
Tropical Japonica  504 64.90% 35.10% 0.00% 0.00% NA
Japonica Intermediate  241 30.70% 69.30% 0.00% 0.00% NA
VI/Aromatic  96 40.60% 59.40% 0.00% 0.00% NA
Intermediate  90 70.00% 28.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0314931433 T -> C LOC_Os03g26044.1 upstream_gene_variant ; 1037.0bp to feature; MODIFIER silent_mutation Average:65.995; most accessible tissue: Callus, score: 92.514 N N N N
vg0314931433 T -> C LOC_Os03g26060.1 upstream_gene_variant ; 2441.0bp to feature; MODIFIER silent_mutation Average:65.995; most accessible tissue: Callus, score: 92.514 N N N N
vg0314931433 T -> C LOC_Os03g26044-LOC_Os03g26060 intergenic_region ; MODIFIER silent_mutation Average:65.995; most accessible tissue: Callus, score: 92.514 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0314931433 NA 7.49E-06 mr1502 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314931433 NA 3.67E-13 mr1740 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314931433 4.29E-06 NA mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314931433 4.36E-06 2.80E-07 mr1035_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314931433 NA 1.64E-07 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314931433 8.91E-06 1.05E-38 mr1533_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314931433 NA 8.12E-14 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314931433 NA 9.50E-06 mr1583_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314931433 NA 5.11E-06 mr1631_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251