\
| Variant ID: vg0314931433 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 14931433 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 241. )
GCGGACAGCCATGTTTAGAAGGGCAATTTAATTTGATGATCTAGGGTGTCAAGCGTGTTGAGTATTTTAGATCTTTCAGTTGAGGCATTGAGCCATTGAA[T/C]
ATCTCGGGCATCATGTCCGTCGGTTTGTCCTCGATCTGGCGGTTGTGACACATGTGTAGTTTATGTTACAGTTAAAAAGAAAAGCCTTACGAGCCTATAG
CTATAGGCTCGTAAGGCTTTTCTTTTTAACTGTAACATAAACTACACATGTGTCACAACCGCCAGATCGAGGACAAACCGACGGACATGATGCCCGAGAT[A/G]
TTCAATGGCTCAATGCCTCAACTGAAAGATCTAAAATACTCAACACGCTTGACACCCTAGATCATCAAATTAAATTGCCCTTCTAAACATGGCTGTCCGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.50% | 24.30% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 31.50% | 68.10% | 0.33% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 9.90% | 89.40% | 0.65% | 0.00% | NA |
| Tropical Japonica | 504 | 64.90% | 35.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 30.70% | 69.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 40.60% | 59.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 70.00% | 28.90% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0314931433 | T -> C | LOC_Os03g26044.1 | upstream_gene_variant ; 1037.0bp to feature; MODIFIER | silent_mutation | Average:65.995; most accessible tissue: Callus, score: 92.514 | N | N | N | N |
| vg0314931433 | T -> C | LOC_Os03g26060.1 | upstream_gene_variant ; 2441.0bp to feature; MODIFIER | silent_mutation | Average:65.995; most accessible tissue: Callus, score: 92.514 | N | N | N | N |
| vg0314931433 | T -> C | LOC_Os03g26044-LOC_Os03g26060 | intergenic_region ; MODIFIER | silent_mutation | Average:65.995; most accessible tissue: Callus, score: 92.514 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0314931433 | NA | 7.49E-06 | mr1502 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314931433 | NA | 3.67E-13 | mr1740 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314931433 | 4.29E-06 | NA | mr1035_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314931433 | 4.36E-06 | 2.80E-07 | mr1035_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314931433 | NA | 1.64E-07 | mr1422_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314931433 | 8.91E-06 | 1.05E-38 | mr1533_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314931433 | NA | 8.12E-14 | mr1533_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314931433 | NA | 9.50E-06 | mr1583_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314931433 | NA | 5.11E-06 | mr1631_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |