\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314912614:

Variant ID: vg0314912614 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 14912614
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


AGATCATAGCAAAGGAAGAACTAGAGCAGGAGAGGTGAAGAACAGAGGAGGAGGAGACAGAGTCGAGGAAGAAAGGGGCAGAGCAGAGTTGTTGAGAGGA[G/A]
AGATTCGTTTTTCCTTTCTTCATTTCACACCTCTCTTCATTACAGGGTTCCTTACTTATAAAGATCATACATGCCAGCCTGGCCGCTTGGCCGAATCACA

Reverse complement sequence

TGTGATTCGGCCAAGCGGCCAGGCTGGCATGTATGATCTTTATAAGTAAGGAACCCTGTAATGAAGAGAGGTGTGAAATGAAGAAAGGAAAAACGAATCT[C/T]
TCCTCTCAACAACTCTGCTCTGCCCCTTTCTTCCTCGACTCTGTCTCCTCCTCCTCTGTTCTTCACCTCTCCTGCTCTAGTTCTTCCTTTGCTATGATCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.80% 18.90% 0.70% 0.61% NA
All Indica  2759 69.40% 28.40% 1.16% 1.01% NA
All Japonica  1512 99.70% 0.20% 0.07% 0.07% NA
Aus  269 67.30% 32.70% 0.00% 0.00% NA
Indica I  595 42.90% 53.30% 3.03% 0.84% NA
Indica II  465 58.30% 38.30% 1.94% 1.51% NA
Indica III  913 89.50% 10.00% 0.11% 0.44% NA
Indica Intermediate  786 72.80% 25.20% 0.51% 1.53% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.00% 0.20% 0.00% NA
Japonica Intermediate  241 98.80% 0.80% 0.00% 0.41% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 81.10% 18.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0314912614 G -> A LOC_Os03g26010.1 upstream_gene_variant ; 3654.0bp to feature; MODIFIER silent_mutation Average:57.601; most accessible tissue: Minghui63 flag leaf, score: 71.577 N N N N
vg0314912614 G -> A LOC_Os03g26030.1 upstream_gene_variant ; 2933.0bp to feature; MODIFIER silent_mutation Average:57.601; most accessible tissue: Minghui63 flag leaf, score: 71.577 N N N N
vg0314912614 G -> A LOC_Os03g26020.1 intron_variant ; MODIFIER silent_mutation Average:57.601; most accessible tissue: Minghui63 flag leaf, score: 71.577 N N N N
vg0314912614 G -> DEL N N silent_mutation Average:57.601; most accessible tissue: Minghui63 flag leaf, score: 71.577 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0314912614 9.04E-06 7.33E-06 mr1217 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314912614 1.53E-06 1.53E-06 mr1293 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314912614 NA 6.51E-06 mr1297 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314912614 2.71E-06 2.72E-06 mr1345 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314912614 NA 5.83E-07 mr1376 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314912614 NA 3.98E-06 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314912614 NA 5.83E-07 mr1431 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314912614 NA 1.06E-06 mr1484 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314912614 NA 2.92E-06 mr1500 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314912614 1.63E-06 3.10E-07 mr1500 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314912614 1.93E-06 3.27E-07 mr1505 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314912614 2.71E-09 NA mr1542 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314912614 3.57E-07 3.15E-07 mr1542 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314912614 NA 2.86E-06 mr1634 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314912614 NA 1.70E-07 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314912614 NA 9.33E-06 mr1956 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314912614 NA 6.50E-07 mr1959 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314912614 1.00E-08 NA mr1542_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314912614 5.31E-08 3.85E-08 mr1542_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314912614 NA 7.88E-06 mr1671_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251