\
| Variant ID: vg0314891832 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 14891832 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, C: 0.01, others allele: 0.00, population size: 119. )
GCCTCGGGGCGAGGCAGCGCGAGGGCCCGAGGGGTGTGACGTGGAACCCCGAGGCCCCCTGGCTGCTTCTGCGACTCGCGAGACGCGGGGGGAGGGCCAG[G/C]
CTGTAGAGCCACGTGGCTGGATGGGAAGGTGACTTCCCCTCACTTTGCATTCCCCCGGGCCTATATCTCCGATAGCCCTGTTTCTTTTAGCTTGGGATTA
TAATCCCAAGCTAAAAGAAACAGGGCTATCGGAGATATAGGCCCGGGGGAATGCAAAGTGAGGGGAAGTCACCTTCCCATCCAGCCACGTGGCTCTACAG[C/G]
CTGGCCCTCCCCCCGCGTCTCGCGAGTCGCAGAAGCAGCCAGGGGGCCTCGGGGTTCCACGTCACACCCCTCGGGCCCTCGCGCTGCCTCGCCCCGAGGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.30% | 15.70% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 77.00% | 22.90% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 68.00% | 32.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 49.70% | 49.70% | 0.50% | 0.00% | NA |
| Indica II | 465 | 60.00% | 40.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 96.50% | 3.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 85.00% | 15.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 17.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0314891832 | G -> C | LOC_Os03g25990.1 | upstream_gene_variant ; 2882.0bp to feature; MODIFIER | silent_mutation | Average:69.145; most accessible tissue: Zhenshan97 panicle, score: 87.126 | N | N | N | N |
| vg0314891832 | G -> C | LOC_Os03g25984.1 | downstream_gene_variant ; 2187.0bp to feature; MODIFIER | silent_mutation | Average:69.145; most accessible tissue: Zhenshan97 panicle, score: 87.126 | N | N | N | N |
| vg0314891832 | G -> C | LOC_Os03g25984-LOC_Os03g25990 | intergenic_region ; MODIFIER | silent_mutation | Average:69.145; most accessible tissue: Zhenshan97 panicle, score: 87.126 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0314891832 | NA | 2.70E-06 | mr1111 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314891832 | NA | 2.73E-07 | mr1237 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314891832 | NA | 1.42E-08 | mr1244 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314891832 | NA | 8.27E-06 | mr1376 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314891832 | NA | 8.27E-06 | mr1431 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314891832 | NA | 2.69E-06 | mr1437 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314891832 | NA | 5.15E-06 | mr1500 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314891832 | 1.92E-06 | 6.87E-06 | mr1505 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314891832 | NA | 3.61E-06 | mr1526 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314891832 | 2.71E-08 | NA | mr1542 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314891832 | 1.78E-07 | 2.26E-08 | mr1542 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314891832 | NA | 3.21E-06 | mr1634 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314891832 | NA | 2.58E-07 | mr1212_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314891832 | 1.63E-07 | NA | mr1542_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314891832 | 9.82E-08 | 5.95E-09 | mr1542_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |