\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314891832:

Variant ID: vg0314891832 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 14891832
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, C: 0.01, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:


GCCTCGGGGCGAGGCAGCGCGAGGGCCCGAGGGGTGTGACGTGGAACCCCGAGGCCCCCTGGCTGCTTCTGCGACTCGCGAGACGCGGGGGGAGGGCCAG[G/C]
CTGTAGAGCCACGTGGCTGGATGGGAAGGTGACTTCCCCTCACTTTGCATTCCCCCGGGCCTATATCTCCGATAGCCCTGTTTCTTTTAGCTTGGGATTA

Reverse complement sequence

TAATCCCAAGCTAAAAGAAACAGGGCTATCGGAGATATAGGCCCGGGGGAATGCAAAGTGAGGGGAAGTCACCTTCCCATCCAGCCACGTGGCTCTACAG[C/G]
CTGGCCCTCCCCCCGCGTCTCGCGAGTCGCAGAAGCAGCCAGGGGGCCTCGGGGTTCCACGTCACACCCCTCGGGCCCTCGCGCTGCCTCGCCCCGAGGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.30% 15.70% 0.06% 0.00% NA
All Indica  2759 77.00% 22.90% 0.11% 0.00% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 68.00% 32.00% 0.00% 0.00% NA
Indica I  595 49.70% 49.70% 0.50% 0.00% NA
Indica II  465 60.00% 40.00% 0.00% 0.00% NA
Indica III  913 96.50% 3.50% 0.00% 0.00% NA
Indica Intermediate  786 85.00% 15.00% 0.00% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 82.20% 17.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0314891832 G -> C LOC_Os03g25990.1 upstream_gene_variant ; 2882.0bp to feature; MODIFIER silent_mutation Average:69.145; most accessible tissue: Zhenshan97 panicle, score: 87.126 N N N N
vg0314891832 G -> C LOC_Os03g25984.1 downstream_gene_variant ; 2187.0bp to feature; MODIFIER silent_mutation Average:69.145; most accessible tissue: Zhenshan97 panicle, score: 87.126 N N N N
vg0314891832 G -> C LOC_Os03g25984-LOC_Os03g25990 intergenic_region ; MODIFIER silent_mutation Average:69.145; most accessible tissue: Zhenshan97 panicle, score: 87.126 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0314891832 NA 2.70E-06 mr1111 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314891832 NA 2.73E-07 mr1237 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314891832 NA 1.42E-08 mr1244 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314891832 NA 8.27E-06 mr1376 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314891832 NA 8.27E-06 mr1431 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314891832 NA 2.69E-06 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314891832 NA 5.15E-06 mr1500 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314891832 1.92E-06 6.87E-06 mr1505 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314891832 NA 3.61E-06 mr1526 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314891832 2.71E-08 NA mr1542 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314891832 1.78E-07 2.26E-08 mr1542 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314891832 NA 3.21E-06 mr1634 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314891832 NA 2.58E-07 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314891832 1.63E-07 NA mr1542_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314891832 9.82E-08 5.95E-09 mr1542_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251