\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314884097:

Variant ID: vg0314884097 (JBrowse)Variation Type: INDEL
Chromosome: chr03Position: 14884097
Reference Allele: CAlternative Allele: T,CTTACAAGTTTAAGTATCACCCATGCACTTTACTCATTTTTTAA
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:


TGACATCATCTTGACCGGCAAATGAGACCTAGATGAGATATTTTGACAAGTTTTGGAAATTGGATTTGTATTTGAGAGTTTGGGAATCTAGATGATACAC[C/T,CTTACAAGTTTAAGTATCACCCATGCACTTTACTCATTTTTTAA]
CTTACAAGTTTAAGTATCACCCATGCACTTTACTCATTTTTTAAGTACTAGGAATAATGCCCGTGCGTTGCAACGGTAAAGTCGTTTGTTCCAGTGGTAC

Reverse complement sequence

GTACCACTGGAACAAACGACTTTACCGTTGCAACGCACGGGCATTATTCCTAGTACTTAAAAAATGAGTAAAGTGCATGGGTGATACTTAAACTTGTAAG[G/A,TTAAAAAATGAGTAAAGTGCATGGGTGATACTTAAACTTGTAAG]
GTGTATCATCTAGATTCCCAAACTCTCAAATACAAATCCAATTTCCAAAACTTGTCAAAATATCTCATCTAGGTCTCATTTGCCGGTCAAGATGATGTCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.60% 29.90% 0.28% 0.21% CTTACAAGTTTAAGTATCACCCATGCACTTTACTCATTTTTTAA: 0.04%
All Indica  2759 61.90% 37.20% 0.43% 0.33% CTTACAAGTTTAAGTATCACCCATGCACTTTACTCATTTTTTAA: 0.07%
All Japonica  1512 78.10% 21.80% 0.00% 0.07% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 77.80% 21.80% 0.34% 0.00% NA
Indica II  465 78.90% 19.80% 0.65% 0.65% NA
Indica III  913 39.90% 59.40% 0.22% 0.33% CTTACAAGTTTAAGTATCACCCATGCACTTTACTCATTTTTTAA: 0.22%
Indica Intermediate  786 65.50% 33.50% 0.64% 0.38% NA
Temperate Japonica  767 96.70% 3.30% 0.00% 0.00% NA
Tropical Japonica  504 50.60% 49.20% 0.00% 0.20% NA
Japonica Intermediate  241 76.30% 23.70% 0.00% 0.00% NA
VI/Aromatic  96 70.80% 29.20% 0.00% 0.00% NA
Intermediate  90 73.30% 25.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0314884097 C -> T LOC_Os03g25984.1 upstream_gene_variant ; 4985.0bp to feature; MODIFIER silent_mutation Average:63.187; most accessible tissue: Minghui63 panicle, score: 78.92 N N N N
vg0314884097 C -> T LOC_Os03g25980.1 downstream_gene_variant ; 472.0bp to feature; MODIFIER silent_mutation Average:63.187; most accessible tissue: Minghui63 panicle, score: 78.92 N N N N
vg0314884097 C -> T LOC_Os03g25980.2 downstream_gene_variant ; 322.0bp to feature; MODIFIER silent_mutation Average:63.187; most accessible tissue: Minghui63 panicle, score: 78.92 N N N N
vg0314884097 C -> T LOC_Os03g25980-LOC_Os03g25984 intergenic_region ; MODIFIER silent_mutation Average:63.187; most accessible tissue: Minghui63 panicle, score: 78.92 N N N N
vg0314884097 C -> DEL N N silent_mutation Average:63.187; most accessible tissue: Minghui63 panicle, score: 78.92 N N N N
vg0314884097 C -> CTTACAAGTTTAAGTATCACCCATGCACTT TACTCATTTTTTAA LOC_Os03g25984.1 upstream_gene_variant ; 4984.0bp to feature; MODIFIER silent_mutation Average:63.187; most accessible tissue: Minghui63 panicle, score: 78.92 N N N N
vg0314884097 C -> CTTACAAGTTTAAGTATCACCCATGCACTT TACTCATTTTTTAA LOC_Os03g25980.1 downstream_gene_variant ; 473.0bp to feature; MODIFIER silent_mutation Average:63.187; most accessible tissue: Minghui63 panicle, score: 78.92 N N N N
vg0314884097 C -> CTTACAAGTTTAAGTATCACCCATGCACTT TACTCATTTTTTAA LOC_Os03g25980.2 downstream_gene_variant ; 323.0bp to feature; MODIFIER silent_mutation Average:63.187; most accessible tissue: Minghui63 panicle, score: 78.92 N N N N
vg0314884097 C -> CTTACAAGTTTAAGTATCACCCATGCACTT TACTCATTTTTTAA LOC_Os03g25980-LOC_Os03g25984 intergenic_region ; MODIFIER silent_mutation Average:63.187; most accessible tissue: Minghui63 panicle, score: 78.92 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0314884097 NA 1.26E-14 Grain_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0314884097 NA 7.94E-07 mr1088 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314884097 NA 2.84E-06 mr1104 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314884097 NA 1.50E-06 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314884097 NA 8.12E-06 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314884097 NA 5.59E-06 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314884097 NA 3.36E-06 mr1502 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314884097 6.46E-08 NA mr1542 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314884097 2.62E-08 1.78E-17 mr1542 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314884097 NA 3.06E-07 mr1620 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314884097 NA 8.42E-13 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314884097 NA 2.38E-07 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314884097 NA 7.00E-12 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314884097 1.70E-06 NA mr1542_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314884097 5.21E-09 1.08E-18 mr1542_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314884097 NA 2.50E-06 mr1583_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251