\
| Variant ID: vg0314884097 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr03 | Position: 14884097 |
| Reference Allele: C | Alternative Allele: T,CTTACAAGTTTAAGTATCACCCATGCACTTTACTCATTTTTTAA |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 222. )
TGACATCATCTTGACCGGCAAATGAGACCTAGATGAGATATTTTGACAAGTTTTGGAAATTGGATTTGTATTTGAGAGTTTGGGAATCTAGATGATACAC[C/T,CTTACAAGTTTAAGTATCACCCATGCACTTTACTCATTTTTTAA]
CTTACAAGTTTAAGTATCACCCATGCACTTTACTCATTTTTTAAGTACTAGGAATAATGCCCGTGCGTTGCAACGGTAAAGTCGTTTGTTCCAGTGGTAC
GTACCACTGGAACAAACGACTTTACCGTTGCAACGCACGGGCATTATTCCTAGTACTTAAAAAATGAGTAAAGTGCATGGGTGATACTTAAACTTGTAAG[G/A,TTAAAAAATGAGTAAAGTGCATGGGTGATACTTAAACTTGTAAG]
GTGTATCATCTAGATTCCCAAACTCTCAAATACAAATCCAATTTCCAAAACTTGTCAAAATATCTCATCTAGGTCTCATTTGCCGGTCAAGATGATGTCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.60% | 29.90% | 0.28% | 0.21% | CTTACAAGTTTAAGTATCACCCATGCACTTTACTCATTTTTTAA: 0.04% |
| All Indica | 2759 | 61.90% | 37.20% | 0.43% | 0.33% | CTTACAAGTTTAAGTATCACCCATGCACTTTACTCATTTTTTAA: 0.07% |
| All Japonica | 1512 | 78.10% | 21.80% | 0.00% | 0.07% | NA |
| Aus | 269 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 77.80% | 21.80% | 0.34% | 0.00% | NA |
| Indica II | 465 | 78.90% | 19.80% | 0.65% | 0.65% | NA |
| Indica III | 913 | 39.90% | 59.40% | 0.22% | 0.33% | CTTACAAGTTTAAGTATCACCCATGCACTTTACTCATTTTTTAA: 0.22% |
| Indica Intermediate | 786 | 65.50% | 33.50% | 0.64% | 0.38% | NA |
| Temperate Japonica | 767 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 50.60% | 49.20% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 76.30% | 23.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 70.80% | 29.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 73.30% | 25.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0314884097 | C -> T | LOC_Os03g25984.1 | upstream_gene_variant ; 4985.0bp to feature; MODIFIER | silent_mutation | Average:63.187; most accessible tissue: Minghui63 panicle, score: 78.92 | N | N | N | N |
| vg0314884097 | C -> T | LOC_Os03g25980.1 | downstream_gene_variant ; 472.0bp to feature; MODIFIER | silent_mutation | Average:63.187; most accessible tissue: Minghui63 panicle, score: 78.92 | N | N | N | N |
| vg0314884097 | C -> T | LOC_Os03g25980.2 | downstream_gene_variant ; 322.0bp to feature; MODIFIER | silent_mutation | Average:63.187; most accessible tissue: Minghui63 panicle, score: 78.92 | N | N | N | N |
| vg0314884097 | C -> T | LOC_Os03g25980-LOC_Os03g25984 | intergenic_region ; MODIFIER | silent_mutation | Average:63.187; most accessible tissue: Minghui63 panicle, score: 78.92 | N | N | N | N |
| vg0314884097 | C -> DEL | N | N | silent_mutation | Average:63.187; most accessible tissue: Minghui63 panicle, score: 78.92 | N | N | N | N |
| vg0314884097 | C -> CTTACAAGTTTAAGTATCACCCATGCACTT TACTCATTTTTTAA | LOC_Os03g25984.1 | upstream_gene_variant ; 4984.0bp to feature; MODIFIER | silent_mutation | Average:63.187; most accessible tissue: Minghui63 panicle, score: 78.92 | N | N | N | N |
| vg0314884097 | C -> CTTACAAGTTTAAGTATCACCCATGCACTT TACTCATTTTTTAA | LOC_Os03g25980.1 | downstream_gene_variant ; 473.0bp to feature; MODIFIER | silent_mutation | Average:63.187; most accessible tissue: Minghui63 panicle, score: 78.92 | N | N | N | N |
| vg0314884097 | C -> CTTACAAGTTTAAGTATCACCCATGCACTT TACTCATTTTTTAA | LOC_Os03g25980.2 | downstream_gene_variant ; 323.0bp to feature; MODIFIER | silent_mutation | Average:63.187; most accessible tissue: Minghui63 panicle, score: 78.92 | N | N | N | N |
| vg0314884097 | C -> CTTACAAGTTTAAGTATCACCCATGCACTT TACTCATTTTTTAA | LOC_Os03g25980-LOC_Os03g25984 | intergenic_region ; MODIFIER | silent_mutation | Average:63.187; most accessible tissue: Minghui63 panicle, score: 78.92 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0314884097 | NA | 1.26E-14 | Grain_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0314884097 | NA | 7.94E-07 | mr1088 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314884097 | NA | 2.84E-06 | mr1104 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314884097 | NA | 1.50E-06 | mr1179 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314884097 | NA | 8.12E-06 | mr1213 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314884097 | NA | 5.59E-06 | mr1236 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314884097 | NA | 3.36E-06 | mr1502 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314884097 | 6.46E-08 | NA | mr1542 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314884097 | 2.62E-08 | 1.78E-17 | mr1542 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314884097 | NA | 3.06E-07 | mr1620 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314884097 | NA | 8.42E-13 | mr1769 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314884097 | NA | 2.38E-07 | mr1422_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314884097 | NA | 7.00E-12 | mr1533_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314884097 | 1.70E-06 | NA | mr1542_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314884097 | 5.21E-09 | 1.08E-18 | mr1542_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314884097 | NA | 2.50E-06 | mr1583_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |