Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314884035:

Variant ID: vg0314884035 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 14884035
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.60, C: 0.39, others allele: 0.00, population size: 81. )

Flanking Sequence (100 bp) in Reference Genome:

CAACCTCTTTAGGATCTTACGTGACGTGTGACGTTGATGTGGCATGCCACACGAACATGACGTGACATCATCTTGACCGGCAAATGAGACCTAGATGAGA[T/C]
ATTTTGACAAGTTTTGGAAATTGGATTTGTATTTGAGAGTTTGGGAATCTAGATGATACACCCTTACAAGTTTAAGTATCACCCATGCACTTTACTCATT

Reverse complement sequence

AATGAGTAAAGTGCATGGGTGATACTTAAACTTGTAAGGGTGTATCATCTAGATTCCCAAACTCTCAAATACAAATCCAATTTCCAAAACTTGTCAAAAT[A/G]
TCTCATCTAGGTCTCATTTGCCGGTCAAGATGATGTCACGTCATGTTCGTGTGGCATGCCACATCAACGTCACACGTCACGTAAGATCCTAAAGAGGTTG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.40%	30.20%	0.40%	0.00%	NA
All Indica	2759	61.60%	37.80%	0.62%	0.00%	NA
All Japonica	1512	78.10%	21.80%	0.07%	0.00%	NA
Aus	269	98.50%	1.50%	0.00%	0.00%	NA
Indica I	595	77.60%	22.40%	0.00%	0.00%	NA
Indica II	465	79.10%	20.40%	0.43%	0.00%	NA
Indica III	913	39.50%	59.70%	0.77%	0.00%	NA
Indica Intermediate	786	64.80%	34.20%	1.02%	0.00%	NA
Temperate Japonica	767	96.70%	3.30%	0.00%	0.00%	NA
Tropical Japonica	504	50.60%	49.20%	0.20%	0.00%	NA
Japonica Intermediate	241	76.30%	23.70%	0.00%	0.00%	NA
VI/Aromatic	96	70.80%	29.20%	0.00%	0.00%	NA
Intermediate	90	72.20%	26.70%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0314884035	T -> C	LOC_Os03g25980.1	downstream_gene_variant ; 410.0bp to feature; MODIFIER	silent_mutation	Average:60.731; most accessible tissue: Callus, score: 85.258	N	N	N	N
vg0314884035	T -> C	LOC_Os03g25980.2	downstream_gene_variant ; 260.0bp to feature; MODIFIER	silent_mutation	Average:60.731; most accessible tissue: Callus, score: 85.258	N	N	N	N
vg0314884035	T -> C	LOC_Os03g25980-LOC_Os03g25984	intergenic_region ; MODIFIER	silent_mutation	Average:60.731; most accessible tissue: Callus, score: 85.258	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0314884035	2.40E-07	NA	mr1542	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314884035	3.37E-08	3.18E-16	mr1542	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314884035	NA	1.58E-07	mr1733	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314884035	2.13E-06	NA	mr1542_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314884035	4.22E-10	2.73E-17	mr1542_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251