\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314883867:

Variant ID: vg0314883867 (JBrowse)Variation Type: INDEL
Chromosome: chr03Position: 14883867
Reference Allele: CTAAACTCTTAAAATAAlternative Allele: TTAAACTCTTAAAATA,C
Primary Allele: CTAAACTCTTAAAATASecondary Allele: TTAAACTCTTAAAATA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACATTTATATCAGACGCACTTTGATTAATATGGTACTATTTTTTTACAAGTAAAGTGCACAAGCGGTTATTAAACTTATAAGGTTATGTCATTTAGGTTC[CTAAACTCTTAAAATA/TTAAACTCTTAAAATA,C]
TAGATCCAAGTTTTAGAACTTGTCAAAGTGTCATTTAGGTCTTAAAACGTCACAACCTCTTTAGGATCTTACGTGACGTGTGACGTTGATGTGGCATGCC

Reverse complement sequence

GGCATGCCACATCAACGTCACACGTCACGTAAGATCCTAAAGAGGTTGTGACGTTTTAAGACCTAAATGACACTTTGACAAGTTCTAAAACTTGGATCTA[TATTTTAAGAGTTTAG/TATTTTAAGAGTTTAA,G]
GAACCTAAATGACATAACCTTATAAGTTTAATAACCGCTTGTGCACTTTACTTGTAAAAAAATAGTACCATATTAATCAAAGTGCGTCTGATATAAATGT

Allele Frequencies:

Populations Population SizeFrequency of CTAAACTCTTAAAATA(primary allele) Frequency of TTAAACTCTTAAAATA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.90% 34.70% 0.28% 0.06% C: 0.06%
All Indica  2759 61.10% 38.40% 0.40% 0.11% NA
All Japonica  1512 77.10% 22.80% 0.07% 0.00% C: 0.07%
Aus  269 35.70% 64.30% 0.00% 0.00% NA
Indica I  595 77.50% 22.00% 0.50% 0.00% NA
Indica II  465 79.60% 19.80% 0.43% 0.22% NA
Indica III  913 38.90% 60.80% 0.22% 0.11% NA
Indica Intermediate  786 63.60% 35.80% 0.51% 0.13% NA
Temperate Japonica  767 96.70% 3.30% 0.00% 0.00% NA
Tropical Japonica  504 47.80% 52.00% 0.20% 0.00% NA
Japonica Intermediate  241 75.90% 23.70% 0.00% 0.00% C: 0.41%
VI/Aromatic  96 63.50% 34.40% 0.00% 0.00% C: 2.08%
Intermediate  90 66.70% 32.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0314883867 CTAAACTCTTAAAATA -> C LOC_Os03g25980.1 downstream_gene_variant ; 243.0bp to feature; MODIFIER silent_mutation Average:57.215; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N
vg0314883867 CTAAACTCTTAAAATA -> C LOC_Os03g25980.2 downstream_gene_variant ; 93.0bp to feature; MODIFIER silent_mutation Average:57.215; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N
vg0314883867 CTAAACTCTTAAAATA -> C LOC_Os03g25980-LOC_Os03g25984 intergenic_region ; MODIFIER silent_mutation Average:57.215; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N
vg0314883867 CTAAACTCTTAAAATA -> TTAAACTCTTAAAATA LOC_Os03g25980.1 downstream_gene_variant ; 242.0bp to feature; MODIFIER silent_mutation Average:57.215; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N
vg0314883867 CTAAACTCTTAAAATA -> TTAAACTCTTAAAATA LOC_Os03g25980.2 downstream_gene_variant ; 92.0bp to feature; MODIFIER silent_mutation Average:57.215; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N
vg0314883867 CTAAACTCTTAAAATA -> TTAAACTCTTAAAATA LOC_Os03g25980-LOC_Os03g25984 intergenic_region ; MODIFIER silent_mutation Average:57.215; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N
vg0314883867 CTAAACTCTTAAAATA -> DEL N N silent_mutation Average:57.215; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0314883867 NA 4.39E-15 Grain_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0314883867 NA 3.89E-06 mr1088 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314883867 NA 2.97E-06 mr1125 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314883867 NA 3.35E-06 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314883867 NA 4.90E-06 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314883867 NA 2.77E-06 mr1502 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314883867 2.03E-06 NA mr1542 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314883867 7.61E-08 1.59E-17 mr1542 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314883867 NA 6.69E-07 mr1620 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314883867 NA 1.90E-14 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314883867 NA 2.51E-08 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314883867 NA 8.59E-14 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314883867 6.34E-09 5.35E-19 mr1542_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314883867 NA 7.02E-07 mr1583_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314883867 NA 1.04E-06 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314883867 NA 3.36E-06 mr1873_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314883867 NA 1.35E-06 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314883867 NA 5.32E-10 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251