Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314883867:

Variant ID: vg0314883867 (JBrowse)	Variation Type: INDEL
Chromosome: chr03	Position: 14883867
Reference Allele: CTAAACTCTTAAAATA	Alternative Allele: TTAAACTCTTAAAATA,C
Primary Allele: CTAAACTCTTAAAATA	Secondary Allele: TTAAACTCTTAAAATA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACATTTATATCAGACGCACTTTGATTAATATGGTACTATTTTTTTACAAGTAAAGTGCACAAGCGGTTATTAAACTTATAAGGTTATGTCATTTAGGTTC[CTAAACTCTTAAAATA/TTAAACTCTTAAAATA,C]
TAGATCCAAGTTTTAGAACTTGTCAAAGTGTCATTTAGGTCTTAAAACGTCACAACCTCTTTAGGATCTTACGTGACGTGTGACGTTGATGTGGCATGCC

Reverse complement sequence

GGCATGCCACATCAACGTCACACGTCACGTAAGATCCTAAAGAGGTTGTGACGTTTTAAGACCTAAATGACACTTTGACAAGTTCTAAAACTTGGATCTA[TATTTTAAGAGTTTAG/TATTTTAAGAGTTTAA,G]
GAACCTAAATGACATAACCTTATAAGTTTAATAACCGCTTGTGCACTTTACTTGTAAAAAAATAGTACCATATTAATCAAAGTGCGTCTGATATAAATGT

Allele Frequencies:

Populations	Population Size	Frequency of CTAAACTCTTAAAATA(primary allele)	Frequency of TTAAACTCTTAAAATA(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.90%	34.70%	0.28%	0.06%	C: 0.06%
All Indica	2759	61.10%	38.40%	0.40%	0.11%	NA
All Japonica	1512	77.10%	22.80%	0.07%	0.00%	C: 0.07%
Aus	269	35.70%	64.30%	0.00%	0.00%	NA
Indica I	595	77.50%	22.00%	0.50%	0.00%	NA
Indica II	465	79.60%	19.80%	0.43%	0.22%	NA
Indica III	913	38.90%	60.80%	0.22%	0.11%	NA
Indica Intermediate	786	63.60%	35.80%	0.51%	0.13%	NA
Temperate Japonica	767	96.70%	3.30%	0.00%	0.00%	NA
Tropical Japonica	504	47.80%	52.00%	0.20%	0.00%	NA
Japonica Intermediate	241	75.90%	23.70%	0.00%	0.00%	C: 0.41%
VI/Aromatic	96	63.50%	34.40%	0.00%	0.00%	C: 2.08%
Intermediate	90	66.70%	32.20%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0314883867	CTAAACTCTTAAAATA -> C	LOC_Os03g25980.1	downstream_gene_variant ; 243.0bp to feature; MODIFIER	silent_mutation	Average:57.215; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N
vg0314883867	CTAAACTCTTAAAATA -> C	LOC_Os03g25980.2	downstream_gene_variant ; 93.0bp to feature; MODIFIER	silent_mutation	Average:57.215; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N
vg0314883867	CTAAACTCTTAAAATA -> C	LOC_Os03g25980-LOC_Os03g25984	intergenic_region ; MODIFIER	silent_mutation	Average:57.215; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N
vg0314883867	CTAAACTCTTAAAATA -> TTAAACTCTTAAAATA	LOC_Os03g25980.1	downstream_gene_variant ; 242.0bp to feature; MODIFIER	silent_mutation	Average:57.215; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N
vg0314883867	CTAAACTCTTAAAATA -> TTAAACTCTTAAAATA	LOC_Os03g25980.2	downstream_gene_variant ; 92.0bp to feature; MODIFIER	silent_mutation	Average:57.215; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N
vg0314883867	CTAAACTCTTAAAATA -> TTAAACTCTTAAAATA	LOC_Os03g25980-LOC_Os03g25984	intergenic_region ; MODIFIER	silent_mutation	Average:57.215; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N
vg0314883867	CTAAACTCTTAAAATA -> DEL	N	N	silent_mutation	Average:57.215; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0314883867	NA	4.39E-15	Grain_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0314883867	NA	3.89E-06	mr1088	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314883867	NA	2.97E-06	mr1125	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314883867	NA	3.35E-06	mr1179	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314883867	NA	4.90E-06	mr1236	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314883867	NA	2.77E-06	mr1502	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314883867	2.03E-06	NA	mr1542	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314883867	7.61E-08	1.59E-17	mr1542	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314883867	NA	6.69E-07	mr1620	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314883867	NA	1.90E-14	mr1769	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314883867	NA	2.51E-08	mr1422_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314883867	NA	8.59E-14	mr1533_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314883867	6.34E-09	5.35E-19	mr1542_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314883867	NA	7.02E-07	mr1583_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314883867	NA	1.04E-06	mr1606_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314883867	NA	3.36E-06	mr1873_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314883867	NA	1.35E-06	mr1905_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314883867	NA	5.32E-10	mr1916_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251