\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314864088:

Variant ID: vg0314864088 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 14864088
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTGGCTGGAGGTGGAGCACGGCGATGGGATCGGGGCGGCCACCGCTTCAGCTCCCGCCGGCTGCCACCACTCCGGCCCCCGCCCGCCGCCGCTCCAGCCT[G/A]
TGCTCCCCGCAGCCGGCCGAGAGAAAGGAAGAGGGGAGGAAGAAGAAAGAGAGAGAGGATGACATGTGGGGCCCACTGACATGTGGGCCCCACAATTTTT

Reverse complement sequence

AAAAATTGTGGGGCCCACATGTCAGTGGGCCCCACATGTCATCCTCTCTCTCTTTCTTCTTCCTCCCCTCTTCCTTTCTCTCGGCCGGCTGCGGGGAGCA[C/T]
AGGCTGGAGCGGCGGCGGGCGGGGGCCGGAGTGGTGGCAGCCGGCGGGAGCTGAAGCGGTGGCCGCCCCGATCCCATCGCCGTGCTCCACCTCCAGCCAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.60% 27.70% 1.12% 1.54% NA
All Indica  2759 61.60% 34.40% 1.56% 2.43% NA
All Japonica  1512 78.60% 20.50% 0.53% 0.40% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 76.80% 22.70% 0.50% 0.00% NA
Indica II  465 80.40% 18.50% 0.86% 0.22% NA
Indica III  913 38.10% 52.60% 2.96% 6.35% NA
Indica Intermediate  786 66.30% 31.60% 1.15% 1.02% NA
Temperate Japonica  767 96.60% 3.10% 0.26% 0.00% NA
Tropical Japonica  504 52.20% 45.60% 0.99% 1.19% NA
Japonica Intermediate  241 76.30% 23.20% 0.41% 0.00% NA
VI/Aromatic  96 70.80% 29.20% 0.00% 0.00% NA
Intermediate  90 74.40% 23.30% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0314864088 G -> A LOC_Os03g25945.1 downstream_gene_variant ; 3635.0bp to feature; MODIFIER silent_mutation Average:93.516; most accessible tissue: Zhenshan97 root, score: 98.886 N N N N
vg0314864088 G -> A LOC_Os03g25960.1 downstream_gene_variant ; 2565.0bp to feature; MODIFIER silent_mutation Average:93.516; most accessible tissue: Zhenshan97 root, score: 98.886 N N N N
vg0314864088 G -> A LOC_Os03g25950.1 intron_variant ; MODIFIER silent_mutation Average:93.516; most accessible tissue: Zhenshan97 root, score: 98.886 N N N N
vg0314864088 G -> DEL N N silent_mutation Average:93.516; most accessible tissue: Zhenshan97 root, score: 98.886 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0314864088 G A -0.01 -0.02 -0.01 -0.02 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0314864088 NA 9.61E-14 Grain_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0314864088 NA 1.97E-06 mr1088 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314864088 NA 7.41E-06 mr1104 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314864088 NA 1.42E-06 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314864088 NA 7.80E-06 mr1502 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314864088 2.37E-06 NA mr1542 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314864088 1.44E-06 2.78E-13 mr1542 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314864088 NA 6.51E-07 mr1620 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314864088 NA 2.12E-07 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314864088 1.76E-07 2.23E-15 mr1542_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314864088 NA 3.55E-06 mr1583_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251