Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314864088:

Variant ID: vg0314864088 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 14864088
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTGGCTGGAGGTGGAGCACGGCGATGGGATCGGGGCGGCCACCGCTTCAGCTCCCGCCGGCTGCCACCACTCCGGCCCCCGCCCGCCGCCGCTCCAGCCT[G/A]
TGCTCCCCGCAGCCGGCCGAGAGAAAGGAAGAGGGGAGGAAGAAGAAAGAGAGAGAGGATGACATGTGGGGCCCACTGACATGTGGGCCCCACAATTTTT

Reverse complement sequence

AAAAATTGTGGGGCCCACATGTCAGTGGGCCCCACATGTCATCCTCTCTCTCTTTCTTCTTCCTCCCCTCTTCCTTTCTCTCGGCCGGCTGCGGGGAGCA[C/T]
AGGCTGGAGCGGCGGCGGGCGGGGGCCGGAGTGGTGGCAGCCGGCGGGAGCTGAAGCGGTGGCCGCCCCGATCCCATCGCCGTGCTCCACCTCCAGCCAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.60%	27.70%	1.12%	1.54%	NA
All Indica	2759	61.60%	34.40%	1.56%	2.43%	NA
All Japonica	1512	78.60%	20.50%	0.53%	0.40%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	76.80%	22.70%	0.50%	0.00%	NA
Indica II	465	80.40%	18.50%	0.86%	0.22%	NA
Indica III	913	38.10%	52.60%	2.96%	6.35%	NA
Indica Intermediate	786	66.30%	31.60%	1.15%	1.02%	NA
Temperate Japonica	767	96.60%	3.10%	0.26%	0.00%	NA
Tropical Japonica	504	52.20%	45.60%	0.99%	1.19%	NA
Japonica Intermediate	241	76.30%	23.20%	0.41%	0.00%	NA
VI/Aromatic	96	70.80%	29.20%	0.00%	0.00%	NA
Intermediate	90	74.40%	23.30%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0314864088	G -> A	LOC_Os03g25945.1	downstream_gene_variant ; 3635.0bp to feature; MODIFIER	silent_mutation	Average:93.516; most accessible tissue: Zhenshan97 root, score: 98.886	N	N	N	N
vg0314864088	G -> A	LOC_Os03g25960.1	downstream_gene_variant ; 2565.0bp to feature; MODIFIER	silent_mutation	Average:93.516; most accessible tissue: Zhenshan97 root, score: 98.886	N	N	N	N
vg0314864088	G -> A	LOC_Os03g25950.1	intron_variant ; MODIFIER	silent_mutation	Average:93.516; most accessible tissue: Zhenshan97 root, score: 98.886	N	N	N	N
vg0314864088	G -> DEL	N	N	silent_mutation	Average:93.516; most accessible tissue: Zhenshan97 root, score: 98.886	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0314864088	G	A	-0.01	-0.02	-0.01	-0.02	-0.01	0.0

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0314864088	NA	9.61E-14	Grain_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0314864088	NA	1.97E-06	mr1088	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314864088	NA	7.41E-06	mr1104	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314864088	NA	1.42E-06	mr1179	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314864088	NA	7.80E-06	mr1502	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314864088	2.37E-06	NA	mr1542	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314864088	1.44E-06	2.78E-13	mr1542	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314864088	NA	6.51E-07	mr1620	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314864088	NA	2.12E-07	mr1422_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314864088	1.76E-07	2.23E-15	mr1542_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314864088	NA	3.55E-06	mr1583_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251