| Variant ID: vg0314847905 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 14847905 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.06, others allele: 0.00, population size: 109. )
TTCACCTAGTGTACTCACAATGTTTCACTATATATAGATCTAATGTTACAGTGAAATGAAACATTCTTTCGCTATTTGCTGAAACATTATTTTTATATAA[A/G]
GTGAAACAACACCCGATTTAAACGAGTGAAACATTTTCAATCTACTTAGTAAAACAATTCCAATATATCATGCAACATTTAAAAATAATTCAATAATAAG
CTTATTATTGAATTATTTTTAAATGTTGCATGATATATTGGAATTGTTTTACTAAGTAGATTGAAAATGTTTCACTCGTTTAAATCGGGTGTTGTTTCAC[T/C]
TTATATAAAAATAATGTTTCAGCAAATAGCGAAAGAATGTTTCATTTCACTGTAACATTAGATCTATATATAGTGAAACATTGTGAGTACACTAGGTGAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.10% | 30.50% | 0.30% | 0.08% | NA |
| All Indica | 2759 | 70.00% | 29.50% | 0.36% | 0.14% | NA |
| All Japonica | 1512 | 80.00% | 19.80% | 0.20% | 0.00% | NA |
| Aus | 269 | 1.50% | 98.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 47.10% | 51.80% | 1.18% | 0.00% | NA |
| Indica II | 465 | 59.40% | 40.20% | 0.22% | 0.22% | NA |
| Indica III | 913 | 86.60% | 13.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 74.40% | 24.90% | 0.25% | 0.38% | NA |
| Temperate Japonica | 767 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 56.70% | 42.70% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 75.10% | 24.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 68.80% | 30.20% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 61.10% | 38.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0314847905 | A -> DEL | N | N | silent_mutation | Average:39.63; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| vg0314847905 | A -> G | LOC_Os03g25930.1 | upstream_gene_variant ; 560.0bp to feature; MODIFIER | silent_mutation | Average:39.63; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| vg0314847905 | A -> G | LOC_Os03g25940.1 | downstream_gene_variant ; 2381.0bp to feature; MODIFIER | silent_mutation | Average:39.63; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| vg0314847905 | A -> G | LOC_Os03g25940.4 | downstream_gene_variant ; 2381.0bp to feature; MODIFIER | silent_mutation | Average:39.63; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| vg0314847905 | A -> G | LOC_Os03g25930-LOC_Os03g25940 | intergenic_region ; MODIFIER | silent_mutation | Average:39.63; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0314847905 | 3.06E-06 | 3.06E-06 | mr1011 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314847905 | NA | 1.47E-06 | mr1040 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314847905 | NA | 6.70E-06 | mr1088 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314847905 | NA | 4.28E-06 | mr1179 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314847905 | NA | 1.35E-06 | mr1236 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314847905 | NA | 3.56E-08 | mr1244 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314847905 | NA | 1.62E-08 | mr1295 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314847905 | NA | 3.51E-06 | mr1437 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314847905 | NA | 5.95E-06 | mr1482 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314847905 | NA | 9.24E-06 | mr1502 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/