\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314847905:

Variant ID: vg0314847905 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 14847905
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.06, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


TTCACCTAGTGTACTCACAATGTTTCACTATATATAGATCTAATGTTACAGTGAAATGAAACATTCTTTCGCTATTTGCTGAAACATTATTTTTATATAA[A/G]
GTGAAACAACACCCGATTTAAACGAGTGAAACATTTTCAATCTACTTAGTAAAACAATTCCAATATATCATGCAACATTTAAAAATAATTCAATAATAAG

Reverse complement sequence

CTTATTATTGAATTATTTTTAAATGTTGCATGATATATTGGAATTGTTTTACTAAGTAGATTGAAAATGTTTCACTCGTTTAAATCGGGTGTTGTTTCAC[T/C]
TTATATAAAAATAATGTTTCAGCAAATAGCGAAAGAATGTTTCATTTCACTGTAACATTAGATCTATATATAGTGAAACATTGTGAGTACACTAGGTGAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.10% 30.50% 0.30% 0.08% NA
All Indica  2759 70.00% 29.50% 0.36% 0.14% NA
All Japonica  1512 80.00% 19.80% 0.20% 0.00% NA
Aus  269 1.50% 98.50% 0.00% 0.00% NA
Indica I  595 47.10% 51.80% 1.18% 0.00% NA
Indica II  465 59.40% 40.20% 0.22% 0.22% NA
Indica III  913 86.60% 13.40% 0.00% 0.00% NA
Indica Intermediate  786 74.40% 24.90% 0.25% 0.38% NA
Temperate Japonica  767 96.70% 3.30% 0.00% 0.00% NA
Tropical Japonica  504 56.70% 42.70% 0.60% 0.00% NA
Japonica Intermediate  241 75.10% 24.90% 0.00% 0.00% NA
VI/Aromatic  96 68.80% 30.20% 1.04% 0.00% NA
Intermediate  90 61.10% 38.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0314847905 A -> DEL N N silent_mutation Average:39.63; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0314847905 A -> G LOC_Os03g25930.1 upstream_gene_variant ; 560.0bp to feature; MODIFIER silent_mutation Average:39.63; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0314847905 A -> G LOC_Os03g25940.1 downstream_gene_variant ; 2381.0bp to feature; MODIFIER silent_mutation Average:39.63; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0314847905 A -> G LOC_Os03g25940.4 downstream_gene_variant ; 2381.0bp to feature; MODIFIER silent_mutation Average:39.63; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0314847905 A -> G LOC_Os03g25930-LOC_Os03g25940 intergenic_region ; MODIFIER silent_mutation Average:39.63; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0314847905 3.06E-06 3.06E-06 mr1011 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314847905 NA 1.47E-06 mr1040 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314847905 NA 6.70E-06 mr1088 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314847905 NA 4.28E-06 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314847905 NA 1.35E-06 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314847905 NA 3.56E-08 mr1244 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314847905 NA 1.62E-08 mr1295 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314847905 NA 3.51E-06 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314847905 NA 5.95E-06 mr1482 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314847905 NA 9.24E-06 mr1502 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314847905 2.38E-09 NA mr1542 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314847905 7.31E-09 9.17E-11 mr1542 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314847905 NA 6.87E-07 mr1620 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314847905 NA 8.78E-14 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314847905 NA 9.10E-08 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314847905 NA 1.94E-13 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314847905 5.31E-10 NA mr1542_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314847905 6.80E-10 2.26E-12 mr1542_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314847905 NA 3.80E-06 mr1583_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314847905 NA 1.16E-06 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314847905 NA 8.05E-07 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314847905 NA 4.79E-06 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314847905 NA 6.54E-06 mr1873_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314847905 NA 5.54E-09 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251