Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314847905:

Variant ID: vg0314847905 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 14847905
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.06, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

TTCACCTAGTGTACTCACAATGTTTCACTATATATAGATCTAATGTTACAGTGAAATGAAACATTCTTTCGCTATTTGCTGAAACATTATTTTTATATAA[A/G]
GTGAAACAACACCCGATTTAAACGAGTGAAACATTTTCAATCTACTTAGTAAAACAATTCCAATATATCATGCAACATTTAAAAATAATTCAATAATAAG

Reverse complement sequence

CTTATTATTGAATTATTTTTAAATGTTGCATGATATATTGGAATTGTTTTACTAAGTAGATTGAAAATGTTTCACTCGTTTAAATCGGGTGTTGTTTCAC[T/C]
TTATATAAAAATAATGTTTCAGCAAATAGCGAAAGAATGTTTCATTTCACTGTAACATTAGATCTATATATAGTGAAACATTGTGAGTACACTAGGTGAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.10%	30.50%	0.30%	0.08%	NA
All Indica	2759	70.00%	29.50%	0.36%	0.14%	NA
All Japonica	1512	80.00%	19.80%	0.20%	0.00%	NA
Aus	269	1.50%	98.50%	0.00%	0.00%	NA
Indica I	595	47.10%	51.80%	1.18%	0.00%	NA
Indica II	465	59.40%	40.20%	0.22%	0.22%	NA
Indica III	913	86.60%	13.40%	0.00%	0.00%	NA
Indica Intermediate	786	74.40%	24.90%	0.25%	0.38%	NA
Temperate Japonica	767	96.70%	3.30%	0.00%	0.00%	NA
Tropical Japonica	504	56.70%	42.70%	0.60%	0.00%	NA
Japonica Intermediate	241	75.10%	24.90%	0.00%	0.00%	NA
VI/Aromatic	96	68.80%	30.20%	1.04%	0.00%	NA
Intermediate	90	61.10%	38.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0314847905	A -> DEL	N	N	silent_mutation	Average:39.63; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N
vg0314847905	A -> G	LOC_Os03g25930.1	upstream_gene_variant ; 560.0bp to feature; MODIFIER	silent_mutation	Average:39.63; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N
vg0314847905	A -> G	LOC_Os03g25940.1	downstream_gene_variant ; 2381.0bp to feature; MODIFIER	silent_mutation	Average:39.63; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N
vg0314847905	A -> G	LOC_Os03g25940.4	downstream_gene_variant ; 2381.0bp to feature; MODIFIER	silent_mutation	Average:39.63; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N
vg0314847905	A -> G	LOC_Os03g25930-LOC_Os03g25940	intergenic_region ; MODIFIER	silent_mutation	Average:39.63; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0314847905	3.06E-06	3.06E-06	mr1011	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314847905	NA	1.47E-06	mr1040	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314847905	NA	6.70E-06	mr1088	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314847905	NA	4.28E-06	mr1179	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314847905	NA	1.35E-06	mr1236	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314847905	NA	3.56E-08	mr1244	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314847905	NA	1.62E-08	mr1295	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314847905	NA	3.51E-06	mr1437	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314847905	NA	5.95E-06	mr1482	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314847905	NA	9.24E-06	mr1502	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314847905	2.38E-09	NA	mr1542	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314847905	7.31E-09	9.17E-11	mr1542	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314847905	NA	6.87E-07	mr1620	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314847905	NA	8.78E-14	mr1769	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314847905	NA	9.10E-08	mr1422_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314847905	NA	1.94E-13	mr1533_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314847905	5.31E-10	NA	mr1542_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314847905	6.80E-10	2.26E-12	mr1542_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314847905	NA	3.80E-06	mr1583_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314847905	NA	1.16E-06	mr1606_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314847905	NA	8.05E-07	mr1662_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314847905	NA	4.79E-06	mr1662_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314847905	NA	6.54E-06	mr1873_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314847905	NA	5.54E-09	mr1916_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251