Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314825243:

Variant ID: vg0314825243 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 14825243
Reference Allele: C	Alternative Allele: T,A
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAGATTGTACTACCCTGATTCCTTGCCGCTCCACCCTTGTGGTACTTCCGTATCCGTGCTCTCTGAGCGCGTATACCAAATATCCCACATACACCGTTGA[C/T,A]
TGTCGAAAAATTGGGAAATGGGTTTGAGAAGCCTTGAAAACCCGACATGTGGTGTCGGTGTGTTTAAAAATAAATGAATTATGAAAACTCGCGATGTGGG

Reverse complement sequence

CCCACATCGCGAGTTTTCATAATTCATTTATTTTTAAACACACCGACACCACATGTCGGGTTTTCAAGGCTTCTCAAACCCATTTCCCAATTTTTCGACA[G/A,T]
TCAACGGTGTATGTGGGATATTTGGTATACGCGCTCAGAGAGCACGGATACGGAAGTACCACAAGGGTGGAGCGGCAAGGAATCAGGGTAGTACAATCTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.80%	7.10%	2.56%	17.52%	A: 0.02%
All Indica	2759	76.10%	0.00%	2.25%	21.64%	NA
All Japonica	1512	79.30%	19.70%	0.00%	0.93%	A: 0.07%
Aus	269	5.90%	0.40%	20.45%	73.23%	NA
Indica I	595	56.30%	0.00%	2.52%	41.18%	NA
Indica II	465	61.30%	0.00%	3.87%	34.84%	NA
Indica III	913	91.70%	0.00%	2.30%	6.02%	NA
Indica Intermediate	786	81.70%	0.10%	1.02%	17.18%	NA
Temperate Japonica	767	96.70%	3.10%	0.00%	0.13%	NA
Tropical Japonica	504	54.60%	43.30%	0.00%	1.98%	A: 0.20%
Japonica Intermediate	241	75.50%	23.20%	0.00%	1.24%	NA
VI/Aromatic	96	70.80%	24.00%	0.00%	5.21%	NA
Intermediate	90	66.70%	12.20%	4.44%	16.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0314825243	C -> T	LOC_Os03g25900.1	downstream_gene_variant ; 3259.0bp to feature; MODIFIER	silent_mutation	Average:41.681; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg0314825243	C -> T	LOC_Os03g25900-LOC_Os03g25910	intergenic_region ; MODIFIER	silent_mutation	Average:41.681; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg0314825243	C -> A	LOC_Os03g25900.1	downstream_gene_variant ; 3259.0bp to feature; MODIFIER	silent_mutation	Average:41.681; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg0314825243	C -> A	LOC_Os03g25900-LOC_Os03g25910	intergenic_region ; MODIFIER	silent_mutation	Average:41.681; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg0314825243	C -> DEL	N	N	silent_mutation	Average:41.681; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0314825243	NA	3.76E-16	Grain_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0314825243	NA	4.15E-06	mr1125	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314825243	NA	3.30E-07	mr1295	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314825243	NA	8.78E-06	mr1502	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314825243	1.08E-07	NA	mr1542	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314825243	4.70E-06	1.37E-08	mr1542	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314825243	NA	5.34E-06	mr1620	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314825243	NA	2.44E-07	mr1733	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314825243	NA	1.33E-07	mr1401_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314825243	NA	2.56E-08	mr1422_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314825243	NA	4.41E-13	mr1533_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314825243	7.31E-07	NA	mr1542_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314825243	NA	2.38E-09	mr1542_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314825243	NA	9.88E-07	mr1583_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314825243	NA	2.22E-07	mr1606_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314825243	NA	1.72E-06	mr1662_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314825243	NA	9.80E-06	mr1830_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314825243	NA	9.65E-07	mr1873_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314825243	NA	4.97E-08	mr1905_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314825243	NA	1.30E-10	mr1916_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314825243	NA	1.06E-09	mr1942_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314825243	NA	3.68E-06	mr1980_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251