Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314811183:

Variant ID: vg0314811183 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 14811183
Reference Allele: G	Alternative Allele: A,T
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CACGACCTTCTTCTCCCCGAAAATCCCAAAAACCCTATCCAATCAATTGAGCGCTGGAGGGAGAACGTGTGGTAGTTCCGGGACAGTGTAGGTGGCACCG[G/A,T]
AAGGCCGCCGCTACCCCGCAAGTGATCGCCGGTGACCCCTTGGGGATCAAGCCGGTGCAACACTGCTACTGCTACCACTACTACCTCTACACCGACAAGA

Reverse complement sequence

TCTTGTCGGTGTAGAGGTAGTAGTGGTAGCAGTAGCAGTGTTGCACCGGCTTGATCCCCAAGGGGTCACCGGCGATCACTTGCGGGGTAGCGGCGGCCTT[C/T,A]
CGGTGCCACCTACACTGTCCCGGAACTACCACACGTTCTCCCTCCAGCGCTCAATTGATTGGATAGGGTTTTTGGGATTTTCGGGGAGAAGAAGGTCGTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.00%	7.10%	0.78%	0.00%	T: 0.06%
All Indica	2759	99.90%	0.00%	0.07%	0.00%	T: 0.04%
All Japonica	1512	77.60%	20.10%	2.25%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.60%	0.00%	0.25%	0.00%	T: 0.13%
Temperate Japonica	767	91.80%	3.90%	4.30%	0.00%	NA
Tropical Japonica	504	56.50%	43.30%	0.20%	0.00%	NA
Japonica Intermediate	241	76.80%	23.20%	0.00%	0.00%	NA
VI/Aromatic	96	76.00%	24.00%	0.00%	0.00%	NA
Intermediate	90	87.80%	8.90%	1.11%	0.00%	T: 2.22%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0314811183	G -> T	LOC_Os03g25890.1	downstream_gene_variant ; 525.0bp to feature; MODIFIER	silent_mutation	Average:70.702; most accessible tissue: Zhenshan97 panicle, score: 81.135	N	N	N	N
vg0314811183	G -> T	LOC_Os03g25890-LOC_Os03g25900	intergenic_region ; MODIFIER	silent_mutation	Average:70.702; most accessible tissue: Zhenshan97 panicle, score: 81.135	N	N	N	N
vg0314811183	G -> A	LOC_Os03g25890.1	downstream_gene_variant ; 525.0bp to feature; MODIFIER	silent_mutation	Average:70.702; most accessible tissue: Zhenshan97 panicle, score: 81.135	N	N	N	N
vg0314811183	G -> A	LOC_Os03g25890-LOC_Os03g25900	intergenic_region ; MODIFIER	silent_mutation	Average:70.702; most accessible tissue: Zhenshan97 panicle, score: 81.135	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0314811183	NA	3.17E-06	mr1040	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314811183	NA	5.52E-06	mr1045	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314811183	NA	8.97E-06	mr1088	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314811183	NA	3.04E-06	mr1125	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314811183	NA	5.77E-06	mr1192	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314811183	NA	1.74E-08	mr1206	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314811183	NA	8.32E-06	mr1236	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314811183	NA	7.51E-07	mr1338	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314811183	NA	1.79E-08	mr1539	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314811183	NA	3.68E-06	mr1596	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314811183	NA	6.49E-07	mr1620	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314811183	NA	5.86E-06	mr1729	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314811183	NA	6.08E-08	mr1733	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314811183	3.19E-06	NA	mr1741	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314811183	NA	2.72E-06	mr1741	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314811183	NA	1.41E-06	mr1812	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314811183	NA	9.31E-06	mr1898	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314811183	NA	4.69E-06	mr1715_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314811183	NA	2.85E-09	mr1905_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251