\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314811183:

Variant ID: vg0314811183 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 14811183
Reference Allele: GAlternative Allele: A,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CACGACCTTCTTCTCCCCGAAAATCCCAAAAACCCTATCCAATCAATTGAGCGCTGGAGGGAGAACGTGTGGTAGTTCCGGGACAGTGTAGGTGGCACCG[G/A,T]
AAGGCCGCCGCTACCCCGCAAGTGATCGCCGGTGACCCCTTGGGGATCAAGCCGGTGCAACACTGCTACTGCTACCACTACTACCTCTACACCGACAAGA

Reverse complement sequence

TCTTGTCGGTGTAGAGGTAGTAGTGGTAGCAGTAGCAGTGTTGCACCGGCTTGATCCCCAAGGGGTCACCGGCGATCACTTGCGGGGTAGCGGCGGCCTT[C/T,A]
CGGTGCCACCTACACTGTCCCGGAACTACCACACGTTCTCCCTCCAGCGCTCAATTGATTGGATAGGGTTTTTGGGATTTTCGGGGAGAAGAAGGTCGTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.00% 7.10% 0.78% 0.00% T: 0.06%
All Indica  2759 99.90% 0.00% 0.07% 0.00% T: 0.04%
All Japonica  1512 77.60% 20.10% 2.25% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.60% 0.00% 0.25% 0.00% T: 0.13%
Temperate Japonica  767 91.80% 3.90% 4.30% 0.00% NA
Tropical Japonica  504 56.50% 43.30% 0.20% 0.00% NA
Japonica Intermediate  241 76.80% 23.20% 0.00% 0.00% NA
VI/Aromatic  96 76.00% 24.00% 0.00% 0.00% NA
Intermediate  90 87.80% 8.90% 1.11% 0.00% T: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0314811183 G -> T LOC_Os03g25890.1 downstream_gene_variant ; 525.0bp to feature; MODIFIER silent_mutation Average:70.702; most accessible tissue: Zhenshan97 panicle, score: 81.135 N N N N
vg0314811183 G -> T LOC_Os03g25890-LOC_Os03g25900 intergenic_region ; MODIFIER silent_mutation Average:70.702; most accessible tissue: Zhenshan97 panicle, score: 81.135 N N N N
vg0314811183 G -> A LOC_Os03g25890.1 downstream_gene_variant ; 525.0bp to feature; MODIFIER silent_mutation Average:70.702; most accessible tissue: Zhenshan97 panicle, score: 81.135 N N N N
vg0314811183 G -> A LOC_Os03g25890-LOC_Os03g25900 intergenic_region ; MODIFIER silent_mutation Average:70.702; most accessible tissue: Zhenshan97 panicle, score: 81.135 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0314811183 NA 3.17E-06 mr1040 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314811183 NA 5.52E-06 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314811183 NA 8.97E-06 mr1088 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314811183 NA 3.04E-06 mr1125 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314811183 NA 5.77E-06 mr1192 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314811183 NA 1.74E-08 mr1206 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314811183 NA 8.32E-06 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314811183 NA 7.51E-07 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314811183 NA 1.79E-08 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314811183 NA 3.68E-06 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314811183 NA 6.49E-07 mr1620 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314811183 NA 5.86E-06 mr1729 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314811183 NA 6.08E-08 mr1733 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314811183 3.19E-06 NA mr1741 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314811183 NA 2.72E-06 mr1741 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314811183 NA 1.41E-06 mr1812 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314811183 NA 9.31E-06 mr1898 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314811183 NA 4.69E-06 mr1715_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314811183 NA 2.85E-09 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251