\
| Variant ID: vg0314801437 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 14801437 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CCCGAAAATCCCAAAAACCCTATCCGATCAATTGAGCGCTGGAGGGAGAACGTGTGGTGTTTCCGGGACAGCGTAGGTGGCGACCAGAAGGCCGCCGCTA[C/T]
CCCGCAAGTGATCGGCGGCGACCCCTTCGGGATCAAGCCGGTGCTCACACTGCTACTGCTACCACTACTACCTCTACACCGACAAGAACAGGGAGAATCG
CGATTCTCCCTGTTCTTGTCGGTGTAGAGGTAGTAGTGGTAGCAGTAGCAGTGTGAGCACCGGCTTGATCCCGAAGGGGTCGCCGCCGATCACTTGCGGG[G/A]
TAGCGGCGGCCTTCTGGTCGCCACCTACGCTGTCCCGGAAACACCACACGTTCTCCCTCCAGCGCTCAATTGATCGGATAGGGTTTTTGGGATTTTCGGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.10% | 6.80% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 80.60% | 19.20% | 0.20% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 57.70% | 41.70% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 76.80% | 23.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 76.00% | 24.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0314801437 | C -> T | LOC_Os03g25869.1 | upstream_gene_variant ; 3409.0bp to feature; MODIFIER | silent_mutation | Average:63.92; most accessible tissue: Zhenshan97 panicle, score: 82.888 | N | N | N | N |
| vg0314801437 | C -> T | LOC_Os03g25869-LOC_Os03g25890 | intergenic_region ; MODIFIER | silent_mutation | Average:63.92; most accessible tissue: Zhenshan97 panicle, score: 82.888 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0314801437 | NA | 3.18E-07 | mr1206 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314801437 | NA | 1.97E-06 | mr1338 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314801437 | NA | 1.17E-06 | mr1502 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314801437 | NA | 4.17E-06 | mr1502 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314801437 | NA | 1.25E-06 | mr1742 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314801437 | NA | 5.47E-06 | mr1898 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314801437 | 2.06E-06 | NA | mr1027_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314801437 | NA | 5.82E-06 | mr1345_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314801437 | NA | 1.17E-11 | mr1533_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314801437 | NA | 3.42E-06 | mr1583_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314801437 | NA | 3.61E-06 | mr1606_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314801437 | NA | 4.52E-08 | mr1819_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314801437 | NA | 8.73E-06 | mr1819_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314801437 | NA | 2.14E-11 | mr1905_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314801437 | NA | 2.88E-07 | mr1905_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |