RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0314801437:

Variant ID: vg0314801437 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 14801437
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCCGAAAATCCCAAAAACCCTATCCGATCAATTGAGCGCTGGAGGGAGAACGTGTGGTGTTTCCGGGACAGCGTAGGTGGCGACCAGAAGGCCGCCGCTA[C/T]
CCCGCAAGTGATCGGCGGCGACCCCTTCGGGATCAAGCCGGTGCTCACACTGCTACTGCTACCACTACTACCTCTACACCGACAAGAACAGGGAGAATCG

Reverse complement sequence

CGATTCTCCCTGTTCTTGTCGGTGTAGAGGTAGTAGTGGTAGCAGTAGCAGTGTGAGCACCGGCTTGATCCCGAAGGGGTCGCCGCCGATCACTTGCGGG[G/A]
TAGCGGCGGCCTTCTGGTCGCCACCTACGCTGTCCCGGAAACACCACACGTTCTCCCTCCAGCGCTCAATTGATCGGATAGGGTTTTTGGGATTTTCGGG

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.10%	6.80%	0.06%	0.00%	NA
All Indica	2759	100.00%	0.00%	0.00%	0.00%	NA
All Japonica	1512	80.60%	19.20%	0.20%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	100.00%	0.00%	0.00%	0.00%	NA
Temperate Japonica	767	96.90%	3.10%	0.00%	0.00%	NA
Tropical Japonica	504	57.70%	41.70%	0.60%	0.00%	NA
Japonica Intermediate	241	76.80%	23.20%	0.00%	0.00%	NA
VI/Aromatic	96	76.00%	24.00%	0.00%	0.00%	NA
Intermediate	90	91.10%	8.90%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0314801437	C -> T	LOC_Os03g25869.1	upstream_gene_variant ; 3409.0bp to feature; MODIFIER	silent_mutation	Average:63.92; most accessible tissue: Zhenshan97 panicle, score: 82.888	N	N	N	N
vg0314801437	C -> T	LOC_Os03g25869-LOC_Os03g25890	intergenic_region ; MODIFIER	silent_mutation	Average:63.92; most accessible tissue: Zhenshan97 panicle, score: 82.888	N	N	N	N

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0314801437	NA	3.18E-07	mr1206	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314801437	NA	1.97E-06	mr1338	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314801437	NA	1.17E-06	mr1502	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314801437	NA	4.17E-06	mr1502	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314801437	NA	1.25E-06	mr1742	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314801437	NA	5.47E-06	mr1898	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314801437	2.06E-06	NA	mr1027_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314801437	NA	5.82E-06	mr1345_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314801437	NA	1.17E-11	mr1533_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314801437	NA	3.42E-06	mr1583_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 15 entries

Previous1 2Next

Search for Variation information by Variation ID:

Detailed information for vg0314801437:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact