Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0314789758:

Variant ID: vg0314789758 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 14789758
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.78, G: 0.21, others allele: 0.00, population size: 70. )

Flanking Sequence (100 bp) in Reference Genome:


GCAACGCGACACCGGAGGCGGCCTCAAATCGACCCGACGTCCACAGCACGCGCGCTGCGCCGCCATTGGTGCTGTTCAAGGCGAGAGAGAAATCTACTAG[A/G]
GTCTTCTCTTCCTCATCACCTTCAGCCAATGCGACGTGGTCGGCCTGCAGGACAATGGACGTGGTGCCGTCAGCGAAGGCGGCAAGGGCGACAACGGCCT

Reverse complement sequence

AGGCCGTTGTCGCCCTTGCCGCCTTCGCTGACGGCACCACGTCCATTGTCCTGCAGGCCGACCACGTCGCATTGGCTGAAGGTGATGAGGAAGAGAAGAC[T/C]
CTAGTAGATTTCTCTCTCGCCTTGAACAGCACCAATGGCGGCGCAGCGCGCGTGCTGTGGACGTCGGGTCGATTTGAGGCCGCCTCCGGTGTCGCGTTGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.10% 28.70% 0.23% 0.06% NA
All Indica  2759 73.40% 26.10% 0.33% 0.11% NA
All Japonica  1512 79.40% 20.60% 0.07% 0.00% NA
Aus  269 1.90% 98.10% 0.00% 0.00% NA
Indica I  595 48.60% 51.10% 0.17% 0.17% NA
Indica II  465 59.60% 39.60% 0.86% 0.00% NA
Indica III  913 91.70% 8.30% 0.00% 0.00% NA
Indica Intermediate  786 79.30% 20.00% 0.51% 0.25% NA
Temperate Japonica  767 96.70% 3.30% 0.00% 0.00% NA
Tropical Japonica  504 54.80% 45.00% 0.20% 0.00% NA
Japonica Intermediate  241 75.50% 24.50% 0.00% 0.00% NA
VI/Aromatic  96 70.80% 29.20% 0.00% 0.00% NA
Intermediate  90 65.60% 33.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0314789758 A -> DEL LOC_Os03g25850.1 N frameshift_variant Average:91.401; most accessible tissue: Minghui63 flag leaf, score: 99.231 N N N N
vg0314789758 A -> G LOC_Os03g25850.1 synonymous_variant ; p.Thr53Thr; LOW synonymous_codon Average:91.401; most accessible tissue: Minghui63 flag leaf, score: 99.231 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0314789758 A G -0.02 0.0 -0.02 0.0 -0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0314789758 NA 6.69E-16 Grain_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0314789758 NA 3.43E-06 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314789758 NA 4.07E-08 mr1244 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314789758 NA 7.75E-08 mr1295 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314789758 NA 8.35E-06 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314789758 5.72E-09 NA mr1542 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314789758 2.95E-08 3.28E-10 mr1542 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314789758 NA 3.62E-07 mr1733 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314789758 NA 7.91E-13 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314789758 NA 5.77E-06 mr1039_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314789758 NA 5.43E-08 mr1401_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314789758 NA 1.85E-08 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314789758 NA 3.83E-13 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314789758 7.25E-09 NA mr1542_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314789758 7.00E-09 1.37E-11 mr1542_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314789758 NA 1.56E-07 mr1583_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314789758 NA 4.05E-08 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314789758 NA 2.58E-07 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314789758 NA 1.84E-06 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314789758 NA 6.36E-06 mr1745_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314789758 NA 5.31E-06 mr1830_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314789758 NA 4.33E-08 mr1873_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314789758 NA 8.58E-09 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314789758 NA 6.36E-12 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314789758 NA 5.20E-10 mr1942_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314789758 NA 3.33E-06 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251