\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314769491:

Variant ID: vg0314769491 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 14769491
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, A: 0.00, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


TATATGCCTTAGATACATGGGGGAGACAGAGAGTGACAATTATTTTCAATGTAATATCATCACCATTTGCATGAGTGGATCTGGCTCGATAAATTTGGTG[C/A]
AAATTTTAATCCATTGTGTAGTGTTGCATGGCAAATCGGCTTGGCAGGACTATATGCTAATTTGACTTACATTGATGTAGCTTTAGGCTTTCGAGGTTAT

Reverse complement sequence

ATAACCTCGAAAGCCTAAAGCTACATCAATGTAAGTCAAATTAGCATATAGTCCTGCCAAGCCGATTTGCCATGCAACACTACACAATGGATTAAAATTT[G/T]
CACCAAATTTATCGAGCCAGATCCACTCATGCAAATGGTGATGATATTACATTGAAAATAATTGTCACTCTCTGTCTCCCCCATGTATCTAAGGCATATA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.10% 29.80% 2.07% 0.00% NA
All Indica  2759 61.60% 35.30% 3.12% 0.00% NA
All Japonica  1512 78.30% 21.40% 0.33% 0.00% NA
Aus  269 98.50% 1.50% 0.00% 0.00% NA
Indica I  595 60.50% 32.90% 6.55% 0.00% NA
Indica II  465 79.60% 18.30% 2.15% 0.00% NA
Indica III  913 53.20% 45.90% 0.88% 0.00% NA
Indica Intermediate  786 61.50% 34.90% 3.69% 0.00% NA
Temperate Japonica  767 96.50% 3.30% 0.26% 0.00% NA
Tropical Japonica  504 54.20% 45.80% 0.00% 0.00% NA
Japonica Intermediate  241 71.00% 27.80% 1.24% 0.00% NA
VI/Aromatic  96 10.40% 86.50% 3.12% 0.00% NA
Intermediate  90 68.90% 26.70% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0314769491 C -> A LOC_Os03g25790.1 downstream_gene_variant ; 1634.0bp to feature; MODIFIER silent_mutation Average:40.206; most accessible tissue: Callus, score: 71.049 N N N N
vg0314769491 C -> A LOC_Os03g25810.1 downstream_gene_variant ; 1503.0bp to feature; MODIFIER silent_mutation Average:40.206; most accessible tissue: Callus, score: 71.049 N N N N
vg0314769491 C -> A LOC_Os03g25790.2 downstream_gene_variant ; 1634.0bp to feature; MODIFIER silent_mutation Average:40.206; most accessible tissue: Callus, score: 71.049 N N N N
vg0314769491 C -> A LOC_Os03g25790-LOC_Os03g25810 intergenic_region ; MODIFIER silent_mutation Average:40.206; most accessible tissue: Callus, score: 71.049 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0314769491 NA 3.58E-15 Grain_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0314769491 NA 4.92E-06 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314769491 NA 7.19E-06 mr1125 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314769491 NA 5.47E-06 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314769491 2.98E-14 NA mr1542 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314769491 4.17E-16 6.78E-33 mr1542 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314769491 NA 1.04E-07 mr1620 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314769491 NA 3.48E-06 mr1780 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314769491 NA 1.04E-07 mr1902 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314769491 NA 1.41E-07 mr1401_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314769491 NA 5.45E-07 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314769491 NA 1.32E-12 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314769491 1.01E-16 NA mr1542_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314769491 3.73E-24 5.64E-41 mr1542_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314769491 NA 1.88E-06 mr1587_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314769491 NA 1.61E-07 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314769491 NA 7.21E-06 mr1853_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314769491 NA 9.09E-06 mr1873_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314769491 NA 3.83E-07 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251