Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314748691:

Variant ID: vg0314748691 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 14748691
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.02, others allele: 0.00, population size: 114. )

Flanking Sequence (100 bp) in Reference Genome:

ATCTTGGTCACTTATTTATTCAATTAGTGCAGGTTAGATATGTATAAGTAGATAATTAGTCCAAATATATTACACCATCTTAAAATATAACAAATTCGAA[T/C]
ATTTTTTTTGCGGGGAACAAATACGAACATTTAATACTCATTTCAGAATATAACATGTTAAATCTCAATCAATCTTCTTTCTCATCTCAACCCACCACAA

Reverse complement sequence

TTGTGGTGGGTTGAGATGAGAAAGAAGATTGATTGAGATTTAACATGTTATATTCTGAAATGAGTATTAAATGTTCGTATTTGTTCCCCGCAAAAAAAAT[A/G]
TTCGAATTTGTTATATTTTAAGATGGTGTAATATATTTGGACTAATTATCTACTTATACATATCTAACCTGCACTAATTGAATAAATAAGTGACCAAGAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.70%	31.50%	1.82%	0.00%	NA
All Indica	2759	85.90%	12.80%	1.27%	0.00%	NA
All Japonica	1512	29.40%	67.30%	3.24%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	95.10%	3.50%	1.34%	0.00%	NA
Indica II	465	96.30%	2.60%	1.08%	0.00%	NA
Indica III	913	73.90%	26.00%	0.11%	0.00%	NA
Indica Intermediate	786	86.60%	10.70%	2.67%	0.00%	NA
Temperate Japonica	767	39.60%	54.50%	5.87%	0.00%	NA
Tropical Japonica	504	20.80%	78.80%	0.40%	0.00%	NA
Japonica Intermediate	241	14.90%	84.20%	0.83%	0.00%	NA
VI/Aromatic	96	15.60%	84.40%	0.00%	0.00%	NA
Intermediate	90	61.10%	36.70%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0314748691	T -> C	LOC_Os03g25770.1	downstream_gene_variant ; 2674.0bp to feature; MODIFIER	silent_mutation	Average:33.415; most accessible tissue: Callus, score: 64.87	N	N	N	N
vg0314748691	T -> C	LOC_Os03g25770.2	downstream_gene_variant ; 2674.0bp to feature; MODIFIER	silent_mutation	Average:33.415; most accessible tissue: Callus, score: 64.87	N	N	N	N
vg0314748691	T -> C	LOC_Os03g25760-LOC_Os03g25770	intergenic_region ; MODIFIER	silent_mutation	Average:33.415; most accessible tissue: Callus, score: 64.87	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0314748691	NA	5.76E-11	mr1128	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314748691	NA	1.70E-09	mr1198	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314748691	NA	3.36E-12	mr1205	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314748691	NA	9.59E-07	mr1278	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314748691	NA	1.16E-08	mr1302	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314748691	NA	2.82E-07	mr1315	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314748691	NA	1.94E-06	mr1392	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314748691	NA	8.85E-07	mr1418	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314748691	NA	3.74E-07	mr1420	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314748691	NA	1.01E-09	mr1488	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314748691	NA	2.33E-09	mr1506	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314748691	NA	8.44E-06	mr1507	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314748691	NA	2.90E-14	mr1521	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314748691	NA	2.23E-20	mr1580	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314748691	NA	1.68E-08	mr1604	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314748691	NA	6.14E-07	mr1773	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314748691	NA	2.42E-11	mr1775	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314748691	NA	7.83E-09	mr1779	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314748691	NA	2.27E-08	mr1797	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314748691	NA	2.27E-08	mr1801	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314748691	NA	8.20E-09	mr1810	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314748691	NA	7.32E-06	mr1811	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314748691	NA	1.22E-08	mr1824	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314748691	NA	8.51E-06	mr1832	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314748691	NA	4.01E-07	mr1886	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314748691	NA	2.62E-06	mr1977	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314748691	1.15E-06	9.57E-09	mr1992	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314748691	4.39E-07	4.39E-07	mr1992	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251