\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314748691:

Variant ID: vg0314748691 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 14748691
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.02, others allele: 0.00, population size: 114. )

Flanking Sequence (100 bp) in Reference Genome:


ATCTTGGTCACTTATTTATTCAATTAGTGCAGGTTAGATATGTATAAGTAGATAATTAGTCCAAATATATTACACCATCTTAAAATATAACAAATTCGAA[T/C]
ATTTTTTTTGCGGGGAACAAATACGAACATTTAATACTCATTTCAGAATATAACATGTTAAATCTCAATCAATCTTCTTTCTCATCTCAACCCACCACAA

Reverse complement sequence

TTGTGGTGGGTTGAGATGAGAAAGAAGATTGATTGAGATTTAACATGTTATATTCTGAAATGAGTATTAAATGTTCGTATTTGTTCCCCGCAAAAAAAAT[A/G]
TTCGAATTTGTTATATTTTAAGATGGTGTAATATATTTGGACTAATTATCTACTTATACATATCTAACCTGCACTAATTGAATAAATAAGTGACCAAGAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.70% 31.50% 1.82% 0.00% NA
All Indica  2759 85.90% 12.80% 1.27% 0.00% NA
All Japonica  1512 29.40% 67.30% 3.24% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 95.10% 3.50% 1.34% 0.00% NA
Indica II  465 96.30% 2.60% 1.08% 0.00% NA
Indica III  913 73.90% 26.00% 0.11% 0.00% NA
Indica Intermediate  786 86.60% 10.70% 2.67% 0.00% NA
Temperate Japonica  767 39.60% 54.50% 5.87% 0.00% NA
Tropical Japonica  504 20.80% 78.80% 0.40% 0.00% NA
Japonica Intermediate  241 14.90% 84.20% 0.83% 0.00% NA
VI/Aromatic  96 15.60% 84.40% 0.00% 0.00% NA
Intermediate  90 61.10% 36.70% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0314748691 T -> C LOC_Os03g25770.1 downstream_gene_variant ; 2674.0bp to feature; MODIFIER silent_mutation Average:33.415; most accessible tissue: Callus, score: 64.87 N N N N
vg0314748691 T -> C LOC_Os03g25770.2 downstream_gene_variant ; 2674.0bp to feature; MODIFIER silent_mutation Average:33.415; most accessible tissue: Callus, score: 64.87 N N N N
vg0314748691 T -> C LOC_Os03g25760-LOC_Os03g25770 intergenic_region ; MODIFIER silent_mutation Average:33.415; most accessible tissue: Callus, score: 64.87 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0314748691 NA 5.76E-11 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314748691 NA 1.70E-09 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314748691 NA 3.36E-12 mr1205 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314748691 NA 9.59E-07 mr1278 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314748691 NA 1.16E-08 mr1302 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314748691 NA 2.82E-07 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314748691 NA 1.94E-06 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314748691 NA 8.85E-07 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314748691 NA 3.74E-07 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314748691 NA 1.01E-09 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314748691 NA 2.33E-09 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314748691 NA 8.44E-06 mr1507 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314748691 NA 2.90E-14 mr1521 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314748691 NA 2.23E-20 mr1580 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314748691 NA 1.68E-08 mr1604 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314748691 NA 6.14E-07 mr1773 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314748691 NA 2.42E-11 mr1775 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314748691 NA 7.83E-09 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314748691 NA 2.27E-08 mr1797 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314748691 NA 2.27E-08 mr1801 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314748691 NA 8.20E-09 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314748691 NA 7.32E-06 mr1811 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314748691 NA 1.22E-08 mr1824 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314748691 NA 8.51E-06 mr1832 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314748691 NA 4.01E-07 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314748691 NA 2.62E-06 mr1977 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314748691 1.15E-06 9.57E-09 mr1992 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314748691 4.39E-07 4.39E-07 mr1992 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251