\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314710737:

Variant ID: vg0314710737 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 14710737
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.85, G: 0.15, others allele: 0.00, population size: 78. )

Flanking Sequence (100 bp) in Reference Genome:


TCTCTCTCTCTCTCTCTCCGGCGATCCCCTCGGTGCGCAAGGCGATCTCGAGGCGACTCTCCCTTTGGCCAAGCTTCCGCCTGCGGAGATGTCGACTTCC[A/G]
CCAGCCCGTCTGCCGCGCCATCAGCCGAATACGCAGAGGTAACTACCCATCGGCTAGATCCTCTCCTTTGTGCAGTAGATTGGTTTTTCCTTATCTCATC

Reverse complement sequence

GATGAGATAAGGAAAAACCAATCTACTGCACAAAGGAGAGGATCTAGCCGATGGGTAGTTACCTCTGCGTATTCGGCTGATGGCGCGGCAGACGGGCTGG[T/C]
GGAAGTCGACATCTCCGCAGGCGGAAGCTTGGCCAAAGGGAGAGTCGCCTCGAGATCGCCTTGCGCACCGAGGGGATCGCCGGAGAGAGAGAGAGAGAGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.70% 24.30% 4.13% 19.87% NA
All Indica  2759 28.50% 40.50% 6.31% 24.65% NA
All Japonica  1512 98.80% 0.10% 0.20% 0.86% NA
Aus  269 10.00% 1.50% 5.20% 83.27% NA
Indica I  595 23.70% 42.00% 3.03% 31.26% NA
Indica II  465 17.40% 21.10% 13.55% 47.96% NA
Indica III  913 36.80% 51.90% 3.18% 8.11% NA
Indica Intermediate  786 29.10% 37.70% 8.14% 25.06% NA
Temperate Japonica  767 99.70% 0.00% 0.13% 0.13% NA
Tropical Japonica  504 97.60% 0.20% 0.40% 1.79% NA
Japonica Intermediate  241 98.30% 0.40% 0.00% 1.24% NA
VI/Aromatic  96 88.50% 5.20% 0.00% 6.25% NA
Intermediate  90 56.70% 21.10% 4.44% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0314710737 A -> DEL N N silent_mutation Average:42.242; most accessible tissue: Zhenshan97 young leaf, score: 73.147 N N N N
vg0314710737 A -> G LOC_Os03g25700.1 intron_variant ; MODIFIER silent_mutation Average:42.242; most accessible tissue: Zhenshan97 young leaf, score: 73.147 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0314710737 NA 7.57E-06 mr1041 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314710737 NA 2.66E-06 mr1293 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314710737 NA 5.73E-06 mr1294 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314710737 5.58E-06 8.07E-09 mr1302 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314710737 NA 1.55E-06 mr1461 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314710737 NA 9.63E-06 mr1502 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314710737 NA 1.62E-06 mr1507 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314710737 NA 6.86E-06 mr1508 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314710737 NA 6.15E-13 mr1542 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314710737 5.08E-06 1.37E-08 mr1604 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314710737 NA 2.15E-06 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314710737 NA 8.59E-06 mr1811 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314710737 1.17E-06 9.38E-07 mr1816 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314710737 NA 9.84E-06 mr1820 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314710737 9.58E-07 3.43E-09 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314710737 NA 3.37E-06 mr1898 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314710737 NA 8.59E-12 mr1542_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251