\
| Variant ID: vg0314710737 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 14710737 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.85, G: 0.15, others allele: 0.00, population size: 78. )
TCTCTCTCTCTCTCTCTCCGGCGATCCCCTCGGTGCGCAAGGCGATCTCGAGGCGACTCTCCCTTTGGCCAAGCTTCCGCCTGCGGAGATGTCGACTTCC[A/G]
CCAGCCCGTCTGCCGCGCCATCAGCCGAATACGCAGAGGTAACTACCCATCGGCTAGATCCTCTCCTTTGTGCAGTAGATTGGTTTTTCCTTATCTCATC
GATGAGATAAGGAAAAACCAATCTACTGCACAAAGGAGAGGATCTAGCCGATGGGTAGTTACCTCTGCGTATTCGGCTGATGGCGCGGCAGACGGGCTGG[T/C]
GGAAGTCGACATCTCCGCAGGCGGAAGCTTGGCCAAAGGGAGAGTCGCCTCGAGATCGCCTTGCGCACCGAGGGGATCGCCGGAGAGAGAGAGAGAGAGA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.70% | 24.30% | 4.13% | 19.87% | NA |
| All Indica | 2759 | 28.50% | 40.50% | 6.31% | 24.65% | NA |
| All Japonica | 1512 | 98.80% | 0.10% | 0.20% | 0.86% | NA |
| Aus | 269 | 10.00% | 1.50% | 5.20% | 83.27% | NA |
| Indica I | 595 | 23.70% | 42.00% | 3.03% | 31.26% | NA |
| Indica II | 465 | 17.40% | 21.10% | 13.55% | 47.96% | NA |
| Indica III | 913 | 36.80% | 51.90% | 3.18% | 8.11% | NA |
| Indica Intermediate | 786 | 29.10% | 37.70% | 8.14% | 25.06% | NA |
| Temperate Japonica | 767 | 99.70% | 0.00% | 0.13% | 0.13% | NA |
| Tropical Japonica | 504 | 97.60% | 0.20% | 0.40% | 1.79% | NA |
| Japonica Intermediate | 241 | 98.30% | 0.40% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 88.50% | 5.20% | 0.00% | 6.25% | NA |
| Intermediate | 90 | 56.70% | 21.10% | 4.44% | 17.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0314710737 | A -> DEL | N | N | silent_mutation | Average:42.242; most accessible tissue: Zhenshan97 young leaf, score: 73.147 | N | N | N | N |
| vg0314710737 | A -> G | LOC_Os03g25700.1 | intron_variant ; MODIFIER | silent_mutation | Average:42.242; most accessible tissue: Zhenshan97 young leaf, score: 73.147 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0314710737 | NA | 7.57E-06 | mr1041 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314710737 | NA | 2.66E-06 | mr1293 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314710737 | NA | 5.73E-06 | mr1294 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314710737 | 5.58E-06 | 8.07E-09 | mr1302 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314710737 | NA | 1.55E-06 | mr1461 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314710737 | NA | 9.63E-06 | mr1502 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314710737 | NA | 1.62E-06 | mr1507 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314710737 | NA | 6.86E-06 | mr1508 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314710737 | NA | 6.15E-13 | mr1542 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314710737 | 5.08E-06 | 1.37E-08 | mr1604 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314710737 | NA | 2.15E-06 | mr1652 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314710737 | NA | 8.59E-06 | mr1811 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314710737 | 1.17E-06 | 9.38E-07 | mr1816 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314710737 | NA | 9.84E-06 | mr1820 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314710737 | 9.58E-07 | 3.43E-09 | mr1886 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314710737 | NA | 3.37E-06 | mr1898 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314710737 | NA | 8.59E-12 | mr1542_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |