Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314706879:

Variant ID: vg0314706879 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 14706879
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACCAAAATTTGGCAGCAAACTAAATGTAGCCACTTTTTTGGCAACGTTACCAAATTTTGGTAAGGTTGAAAATGGCATCAAAGTGAACAGGCCCCACATT[C/T]
CAGATTTGAACATCACGATTTCAGATTACACAATATTGCAGATCTTATTTTCGCAAGGAATCAGAGAAACAACCACAAGTTTTTTAACAAATCAATCACT

Reverse complement sequence

AGTGATTGATTTGTTAAAAAACTTGTGGTTGTTTCTCTGATTCCTTGCGAAAATAAGATCTGCAATATTGTGTAATCTGAAATCGTGATGTTCAAATCTG[G/A]
AATGTGGGGCCTGTTCACTTTGATGCCATTTTCAACCTTACCAAAATTTGGTAACGTTGCCAAAAAAGTGGCTACATTTAGTTTGCTGCCAAATTTTGGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.70%	5.70%	2.69%	21.86%	NA
All Indica	2759	67.70%	0.00%	1.78%	30.45%	NA
All Japonica	1512	76.80%	17.50%	4.70%	0.99%	NA
Aus	269	40.10%	0.00%	1.86%	57.99%	NA
Indica I	595	64.40%	0.00%	1.01%	34.62%	NA
Indica II	465	33.50%	0.00%	4.52%	61.94%	NA
Indica III	913	88.80%	0.00%	0.66%	10.51%	NA
Indica Intermediate	786	66.00%	0.10%	2.04%	31.81%	NA
Temperate Japonica	767	59.30%	31.90%	8.60%	0.13%	NA
Tropical Japonica	504	96.20%	1.40%	0.20%	2.18%	NA
Japonica Intermediate	241	91.70%	5.40%	1.66%	1.24%	NA
VI/Aromatic	96	93.80%	0.00%	1.04%	5.21%	NA
Intermediate	90	74.40%	5.60%	1.11%	18.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0314706879	C -> T	LOC_Os03g25690.1	upstream_gene_variant ; 4902.0bp to feature; MODIFIER	silent_mutation	Average:28.344; most accessible tissue: Zhenshan97 flag leaf, score: 36.135	N	N	N	N
vg0314706879	C -> T	LOC_Os03g25700.1	upstream_gene_variant ; 1683.0bp to feature; MODIFIER	silent_mutation	Average:28.344; most accessible tissue: Zhenshan97 flag leaf, score: 36.135	N	N	N	N
vg0314706879	C -> T	LOC_Os03g25690-LOC_Os03g25700	intergenic_region ; MODIFIER	silent_mutation	Average:28.344; most accessible tissue: Zhenshan97 flag leaf, score: 36.135	N	N	N	N
vg0314706879	C -> DEL	N	N	silent_mutation	Average:28.344; most accessible tissue: Zhenshan97 flag leaf, score: 36.135	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0314706879	8.61E-07	NA	mr1115	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879	1.31E-07	1.25E-29	mr1137	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879	NA	3.94E-12	mr1137	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879	NA	2.15E-07	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879	NA	1.92E-07	mr1164	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879	7.18E-06	NA	mr1198	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879	NA	5.81E-07	mr1202	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879	9.89E-06	NA	mr1210	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879	NA	6.52E-07	mr1252	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879	NA	2.73E-06	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879	1.19E-07	NA	mr1382	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879	1.03E-06	NA	mr1382	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879	NA	4.41E-08	mr1521	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879	1.35E-06	2.35E-09	mr1576	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879	NA	2.54E-06	mr1576	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879	6.37E-07	NA	mr1585	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879	NA	7.49E-06	mr1596	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879	1.47E-06	NA	mr1611	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879	NA	6.02E-06	mr1614	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879	2.35E-08	7.77E-27	mr1617	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879	NA	7.50E-11	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879	NA	6.72E-07	mr1627	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879	NA	1.37E-12	mr1712	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879	NA	9.75E-08	mr1715	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879	NA	4.75E-06	mr1729	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879	2.12E-06	NA	mr1737	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879	NA	1.53E-08	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879	NA	3.65E-06	mr1748	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879	NA	1.64E-08	mr1763	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879	NA	2.99E-07	mr1804	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879	NA	2.80E-06	mr1826	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879	NA	5.56E-06	mr1837	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879	NA	9.88E-06	mr1872	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879	NA	1.25E-06	mr1880	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879	NA	6.27E-06	mr1910	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879	6.99E-07	3.94E-08	mr1955	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879	8.55E-06	8.55E-06	mr1955	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879	NA	6.20E-10	mr1977	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879	NA	3.35E-06	mr1977	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879	7.52E-06	NA	mr1992	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879	6.89E-06	6.89E-06	mr1992	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879	NA	1.39E-09	mr1137_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879	NA	5.36E-06	mr1617_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251