Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314696375:

Variant ID: vg0314696375 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 14696375
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.01, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:

TATTGCAAAAGACCTACAGGTATCGGTACCCAAAATCAGAGGGATCATCATATCATCTCGTTAGAGCATCTTCAGGATATAAAGATTACCAGCGCTTACA[A/G]
ACGACAGTACGAAGCTAGGCTCCTGAAATTCTTACATGCAAGCGCACCGGCCTTGAAGAAGATGATAGTAGCATTCATATCAGCCTTTATGCTATCCCAG

Reverse complement sequence

CTGGGATAGCATAAAGGCTGATATGAATGCTACTATCATCTTCTTCAAGGCCGGTGCGCTTGCATGTAAGAATTTCAGGAGCCTAGCTTCGTACTGTCGT[T/C]
TGTAAGCGCTGGTAATCTTTATATCCTGAAGATGCTCTAACGAGATGATATGATGATCCCTCTGATTTTGGGTACCGATACCTGTAGGTCTTTTGCAATA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	47.10%	24.00%	2.98%	25.86%	NA
All Indica	2759	52.50%	12.40%	1.70%	33.42%	NA
All Japonica	1512	48.80%	44.60%	5.42%	1.12%	NA
Aus	269	1.50%	1.10%	2.97%	94.42%	NA
Indica I	595	56.30%	5.70%	2.18%	35.80%	NA
Indica II	465	28.20%	1.70%	2.37%	67.74%	NA
Indica III	913	63.70%	23.50%	0.55%	12.16%	NA
Indica Intermediate	786	50.90%	10.80%	2.29%	36.01%	NA
Temperate Japonica	767	79.00%	11.60%	9.13%	0.26%	NA
Tropical Japonica	504	17.50%	79.60%	0.79%	2.18%	NA
Japonica Intermediate	241	18.30%	76.80%	3.32%	1.66%	NA
VI/Aromatic	96	6.20%	86.50%	0.00%	7.29%	NA
Intermediate	90	35.60%	35.60%	4.44%	24.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0314696375	A -> DEL	LOC_Os03g25670.1	N	frameshift_variant	Average:40.561; most accessible tissue: Callus, score: 70.488	N	N	N	N
vg0314696375	A -> G	LOC_Os03g25670.1	missense_variant ; p.Lys428Arg; MODERATE	nonsynonymous_codon ; K428R	Average:40.561; most accessible tissue: Callus, score: 70.488	unknown	unknown	TOLERATED	0.87

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0314696375	NA	6.55E-06	mr1045	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314696375	NA	2.74E-12	mr1205	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314696375	NA	2.23E-07	mr1206	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314696375	NA	3.47E-06	mr1319	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314696375	NA	1.39E-17	mr1330	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314696375	NA	9.29E-08	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314696375	NA	2.48E-10	mr1332	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314696375	NA	1.25E-08	mr1338	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314696375	NA	4.47E-06	mr1338	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314696375	NA	1.99E-06	mr1359	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314696375	NA	4.18E-06	mr1438	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314696375	NA	2.55E-11	mr1486	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314696375	NA	1.15E-06	mr1521	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314696375	NA	2.57E-06	mr1527	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314696375	NA	4.19E-06	mr1548	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314696375	NA	5.80E-07	mr1570	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314696375	NA	1.67E-06	mr1576	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314696375	NA	1.27E-06	mr1596	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314696375	NA	3.40E-07	mr1627	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314696375	NA	1.37E-08	mr1729	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314696375	NA	5.49E-08	mr1729	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314696375	NA	4.99E-11	mr1775	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314696375	NA	8.76E-06	mr1788	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314696375	NA	4.31E-06	mr1438_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314696375	NA	1.19E-09	mr1486_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251