\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314696375:

Variant ID: vg0314696375 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 14696375
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.01, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


TATTGCAAAAGACCTACAGGTATCGGTACCCAAAATCAGAGGGATCATCATATCATCTCGTTAGAGCATCTTCAGGATATAAAGATTACCAGCGCTTACA[A/G]
ACGACAGTACGAAGCTAGGCTCCTGAAATTCTTACATGCAAGCGCACCGGCCTTGAAGAAGATGATAGTAGCATTCATATCAGCCTTTATGCTATCCCAG

Reverse complement sequence

CTGGGATAGCATAAAGGCTGATATGAATGCTACTATCATCTTCTTCAAGGCCGGTGCGCTTGCATGTAAGAATTTCAGGAGCCTAGCTTCGTACTGTCGT[T/C]
TGTAAGCGCTGGTAATCTTTATATCCTGAAGATGCTCTAACGAGATGATATGATGATCCCTCTGATTTTGGGTACCGATACCTGTAGGTCTTTTGCAATA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.10% 24.00% 2.98% 25.86% NA
All Indica  2759 52.50% 12.40% 1.70% 33.42% NA
All Japonica  1512 48.80% 44.60% 5.42% 1.12% NA
Aus  269 1.50% 1.10% 2.97% 94.42% NA
Indica I  595 56.30% 5.70% 2.18% 35.80% NA
Indica II  465 28.20% 1.70% 2.37% 67.74% NA
Indica III  913 63.70% 23.50% 0.55% 12.16% NA
Indica Intermediate  786 50.90% 10.80% 2.29% 36.01% NA
Temperate Japonica  767 79.00% 11.60% 9.13% 0.26% NA
Tropical Japonica  504 17.50% 79.60% 0.79% 2.18% NA
Japonica Intermediate  241 18.30% 76.80% 3.32% 1.66% NA
VI/Aromatic  96 6.20% 86.50% 0.00% 7.29% NA
Intermediate  90 35.60% 35.60% 4.44% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0314696375 A -> DEL LOC_Os03g25670.1 N frameshift_variant Average:40.561; most accessible tissue: Callus, score: 70.488 N N N N
vg0314696375 A -> G LOC_Os03g25670.1 missense_variant ; p.Lys428Arg; MODERATE nonsynonymous_codon ; K428R Average:40.561; most accessible tissue: Callus, score: 70.488 unknown unknown TOLERATED 0.87

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0314696375 NA 6.55E-06 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314696375 NA 2.74E-12 mr1205 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314696375 NA 2.23E-07 mr1206 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314696375 NA 3.47E-06 mr1319 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314696375 NA 1.39E-17 mr1330 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314696375 NA 9.29E-08 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314696375 NA 2.48E-10 mr1332 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314696375 NA 1.25E-08 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314696375 NA 4.47E-06 mr1338 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314696375 NA 1.99E-06 mr1359 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314696375 NA 4.18E-06 mr1438 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314696375 NA 2.55E-11 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314696375 NA 1.15E-06 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314696375 NA 2.57E-06 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314696375 NA 4.19E-06 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314696375 NA 5.80E-07 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314696375 NA 1.67E-06 mr1576 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314696375 NA 1.27E-06 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314696375 NA 3.40E-07 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314696375 NA 1.37E-08 mr1729 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314696375 NA 5.49E-08 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314696375 NA 4.99E-11 mr1775 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314696375 NA 8.76E-06 mr1788 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314696375 NA 4.31E-06 mr1438_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314696375 NA 1.19E-09 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251