\
| Variant ID: vg0314687874 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 14687874 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.84, A: 0.16, others allele: 0.00, population size: 74. )
CCTAGCATATGCCTAGCCAAATTGATGCACCAAAATACAAATTGTCAAGTTCTTGTAGTAGAACGCACCTACCTGTCAAGTTGTTACACTTGGACGCTCA[T/A]
TTCTCAAGTTCTTGCACTATATCGCACCCACCTGCCAAGTTGTACCGTGGGTGCAATTTACTCTTCTTTCTTCTACAGATTTTTGGAAGCCAACCTTGCA
TGCAAGGTTGGCTTCCAAAAATCTGTAGAAGAAAGAAGAGTAAATTGCACCCACGGTACAACTTGGCAGGTGGGTGCGATATAGTGCAAGAACTTGAGAA[A/T]
TGAGCGTCCAAGTGTAACAACTTGACAGGTAGGTGCGTTCTACTACAAGAACTTGACAATTTGTATTTTGGTGCATCAATTTGGCTAGGCATATGCTAGG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 43.90% | 29.70% | 0.55% | 25.84% | NA |
| All Indica | 2759 | 16.20% | 49.50% | 0.47% | 33.82% | NA |
| All Japonica | 1512 | 98.70% | 0.10% | 0.00% | 1.12% | NA |
| Aus | 269 | 2.20% | 3.00% | 4.46% | 90.33% | NA |
| Indica I | 595 | 7.90% | 55.50% | 0.34% | 36.30% | NA |
| Indica II | 465 | 7.50% | 22.40% | 1.72% | 68.39% | NA |
| Indica III | 913 | 24.90% | 62.90% | 0.00% | 12.27% | NA |
| Indica Intermediate | 786 | 17.40% | 45.70% | 0.38% | 36.51% | NA |
| Temperate Japonica | 767 | 99.70% | 0.00% | 0.00% | 0.26% | NA |
| Tropical Japonica | 504 | 97.60% | 0.20% | 0.00% | 2.18% | NA |
| Japonica Intermediate | 241 | 97.90% | 0.40% | 0.00% | 1.66% | NA |
| VI/Aromatic | 96 | 87.50% | 5.20% | 0.00% | 7.29% | NA |
| Intermediate | 90 | 51.10% | 24.40% | 1.11% | 23.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0314687874 | T -> A | LOC_Os03g25660.1 | downstream_gene_variant ; 2482.0bp to feature; MODIFIER | silent_mutation | Average:54.683; most accessible tissue: Minghui63 root, score: 67.149 | N | N | N | N |
| vg0314687874 | T -> A | LOC_Os03g25650.1 | intron_variant ; MODIFIER | silent_mutation | Average:54.683; most accessible tissue: Minghui63 root, score: 67.149 | N | N | N | N |
| vg0314687874 | T -> DEL | N | N | silent_mutation | Average:54.683; most accessible tissue: Minghui63 root, score: 67.149 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0314687874 | NA | 5.08E-07 | mr1104 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314687874 | NA | 2.95E-07 | mr1245 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314687874 | NA | 2.27E-07 | mr1690 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314687874 | NA | 1.40E-07 | mr1212_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314687874 | NA | 2.32E-12 | mr1216_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314687874 | 2.33E-06 | NA | mr1542_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |