\
| Variant ID: vg0314687794 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 14687794 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 81. )
TAAAGATTAAATTTAATATCTAAGGTAATATCTGTAGGATTGCTATGTAATGGCATTATTGATATCGGGAAAAAAACTCACCTAGCATATGCCTAGCCAA[A/G]
TTGATGCACCAAAATACAAATTGTCAAGTTCTTGTAGTAGAACGCACCTACCTGTCAAGTTGTTACACTTGGACGCTCATTTCTCAAGTTCTTGCACTAT
ATAGTGCAAGAACTTGAGAAATGAGCGTCCAAGTGTAACAACTTGACAGGTAGGTGCGTTCTACTACAAGAACTTGACAATTTGTATTTTGGTGCATCAA[T/C]
TTGGCTAGGCATATGCTAGGTGAGTTTTTTTCCCGATATCAATAATGCCATTACATAGCAATCCTACAGATATTACCTTAGATATTAAATTTAATCTTTA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 73.50% | 0.70% | 0.89% | 24.84% | NA |
| All Indica | 2759 | 65.70% | 0.10% | 0.87% | 33.35% | NA |
| All Japonica | 1512 | 98.90% | 0.00% | 0.00% | 1.12% | NA |
| Aus | 269 | 3.30% | 12.30% | 6.32% | 78.07% | NA |
| Indica I | 595 | 62.40% | 0.00% | 1.34% | 36.30% | NA |
| Indica II | 465 | 31.00% | 0.00% | 1.29% | 67.74% | NA |
| Indica III | 913 | 87.60% | 0.00% | 0.33% | 12.05% | NA |
| Indica Intermediate | 786 | 63.40% | 0.30% | 0.89% | 35.50% | NA |
| Temperate Japonica | 767 | 99.70% | 0.00% | 0.00% | 0.26% | NA |
| Tropical Japonica | 504 | 97.80% | 0.00% | 0.00% | 2.18% | NA |
| Japonica Intermediate | 241 | 98.30% | 0.00% | 0.00% | 1.66% | NA |
| VI/Aromatic | 96 | 92.70% | 0.00% | 0.00% | 7.29% | NA |
| Intermediate | 90 | 76.70% | 0.00% | 1.11% | 22.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0314687794 | A -> DEL | N | N | silent_mutation | Average:44.522; most accessible tissue: Callus, score: 69.662 | N | N | N | N |
| vg0314687794 | A -> G | LOC_Os03g25660.1 | downstream_gene_variant ; 2562.0bp to feature; MODIFIER | silent_mutation | Average:44.522; most accessible tissue: Callus, score: 69.662 | N | N | N | N |
| vg0314687794 | A -> G | LOC_Os03g25650.1 | intron_variant ; MODIFIER | silent_mutation | Average:44.522; most accessible tissue: Callus, score: 69.662 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0314687794 | NA | 1.85E-06 | mr1139 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314687794 | NA | 4.39E-06 | mr1147 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314687794 | NA | 1.22E-07 | mr1193 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314687794 | NA | 4.27E-06 | mr1204 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314687794 | NA | 7.90E-06 | mr1264 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314687794 | NA | 4.44E-08 | mr1354 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314687794 | NA | 6.70E-06 | mr1408 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314687794 | 9.99E-06 | 1.65E-06 | mr1432 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314687794 | NA | 4.87E-07 | mr1437 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314687794 | 5.08E-10 | 6.41E-46 | mr1542 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314687794 | 1.55E-06 | 2.57E-19 | mr1542 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314687794 | NA | 4.22E-06 | mr1620 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314687794 | NA | 1.55E-07 | mr1690 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314687794 | NA | 8.89E-06 | mr1821 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314687794 | 1.89E-06 | 1.89E-06 | mr1891 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314687794 | 7.65E-06 | 2.50E-06 | mr1895 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314687794 | NA | 2.30E-06 | mr1913 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314687794 | NA | 1.19E-07 | mr1187_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314687794 | NA | 1.88E-07 | mr1212_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314687794 | 8.60E-08 | 7.22E-45 | mr1542_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314687794 | 3.81E-06 | 2.17E-18 | mr1542_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314687794 | NA | 1.41E-15 | mr1587_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |