\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314687794:

Variant ID: vg0314687794 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 14687794
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 81. )

Flanking Sequence (100 bp) in Reference Genome:


TAAAGATTAAATTTAATATCTAAGGTAATATCTGTAGGATTGCTATGTAATGGCATTATTGATATCGGGAAAAAAACTCACCTAGCATATGCCTAGCCAA[A/G]
TTGATGCACCAAAATACAAATTGTCAAGTTCTTGTAGTAGAACGCACCTACCTGTCAAGTTGTTACACTTGGACGCTCATTTCTCAAGTTCTTGCACTAT

Reverse complement sequence

ATAGTGCAAGAACTTGAGAAATGAGCGTCCAAGTGTAACAACTTGACAGGTAGGTGCGTTCTACTACAAGAACTTGACAATTTGTATTTTGGTGCATCAA[T/C]
TTGGCTAGGCATATGCTAGGTGAGTTTTTTTCCCGATATCAATAATGCCATTACATAGCAATCCTACAGATATTACCTTAGATATTAAATTTAATCTTTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.50% 0.70% 0.89% 24.84% NA
All Indica  2759 65.70% 0.10% 0.87% 33.35% NA
All Japonica  1512 98.90% 0.00% 0.00% 1.12% NA
Aus  269 3.30% 12.30% 6.32% 78.07% NA
Indica I  595 62.40% 0.00% 1.34% 36.30% NA
Indica II  465 31.00% 0.00% 1.29% 67.74% NA
Indica III  913 87.60% 0.00% 0.33% 12.05% NA
Indica Intermediate  786 63.40% 0.30% 0.89% 35.50% NA
Temperate Japonica  767 99.70% 0.00% 0.00% 0.26% NA
Tropical Japonica  504 97.80% 0.00% 0.00% 2.18% NA
Japonica Intermediate  241 98.30% 0.00% 0.00% 1.66% NA
VI/Aromatic  96 92.70% 0.00% 0.00% 7.29% NA
Intermediate  90 76.70% 0.00% 1.11% 22.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0314687794 A -> DEL N N silent_mutation Average:44.522; most accessible tissue: Callus, score: 69.662 N N N N
vg0314687794 A -> G LOC_Os03g25660.1 downstream_gene_variant ; 2562.0bp to feature; MODIFIER silent_mutation Average:44.522; most accessible tissue: Callus, score: 69.662 N N N N
vg0314687794 A -> G LOC_Os03g25650.1 intron_variant ; MODIFIER silent_mutation Average:44.522; most accessible tissue: Callus, score: 69.662 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0314687794 NA 1.85E-06 mr1139 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314687794 NA 4.39E-06 mr1147 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314687794 NA 1.22E-07 mr1193 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314687794 NA 4.27E-06 mr1204 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314687794 NA 7.90E-06 mr1264 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314687794 NA 4.44E-08 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314687794 NA 6.70E-06 mr1408 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314687794 9.99E-06 1.65E-06 mr1432 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314687794 NA 4.87E-07 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314687794 5.08E-10 6.41E-46 mr1542 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314687794 1.55E-06 2.57E-19 mr1542 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314687794 NA 4.22E-06 mr1620 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314687794 NA 1.55E-07 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314687794 NA 8.89E-06 mr1821 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314687794 1.89E-06 1.89E-06 mr1891 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314687794 7.65E-06 2.50E-06 mr1895 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314687794 NA 2.30E-06 mr1913 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314687794 NA 1.19E-07 mr1187_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314687794 NA 1.88E-07 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314687794 8.60E-08 7.22E-45 mr1542_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314687794 3.81E-06 2.17E-18 mr1542_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314687794 NA 1.41E-15 mr1587_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251