Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314687749:

Variant ID: vg0314687749 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 14687749
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:

AATTTTAAGGTAATTGGATGTAAACTGTATATGCAATATAATTACTAAAGATTAAATTTAATATCTAAGGTAATATCTGTAGGATTGCTATGTAATGGCA[T/C]
TATTGATATCGGGAAAAAAACTCACCTAGCATATGCCTAGCCAAATTGATGCACCAAAATACAAATTGTCAAGTTCTTGTAGTAGAACGCACCTACCTGT

Reverse complement sequence

ACAGGTAGGTGCGTTCTACTACAAGAACTTGACAATTTGTATTTTGGTGCATCAATTTGGCTAGGCATATGCTAGGTGAGTTTTTTTCCCGATATCAATA[A/G]
TGCCATTACATAGCAATCCTACAGATATTACCTTAGATATTAAATTTAATCTTTAGTAATTATATTGCATATACAGTTTACATCCAATTACCTTAAAATT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.00%	0.20%	0.57%	25.26%	NA
All Indica	2759	66.40%	0.00%	0.58%	32.98%	NA
All Japonica	1512	98.90%	0.00%	0.00%	1.06%	NA
Aus	269	3.70%	3.30%	4.09%	88.85%	NA
Indica I	595	64.40%	0.00%	0.84%	34.79%	NA
Indica II	465	31.40%	0.00%	0.65%	67.96%	NA
Indica III	913	88.20%	0.00%	0.33%	11.50%	NA
Indica Intermediate	786	63.50%	0.00%	0.64%	35.88%	NA
Temperate Japonica	767	99.70%	0.00%	0.00%	0.26%	NA
Tropical Japonica	504	97.80%	0.00%	0.00%	2.18%	NA
Japonica Intermediate	241	98.80%	0.00%	0.00%	1.24%	NA
VI/Aromatic	96	92.70%	0.00%	0.00%	7.29%	NA
Intermediate	90	75.60%	0.00%	0.00%	24.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0314687749	T -> C	LOC_Os03g25660.1	downstream_gene_variant ; 2607.0bp to feature; MODIFIER	silent_mutation	Average:42.664; most accessible tissue: Callus, score: 69.662	N	N	N	N
vg0314687749	T -> C	LOC_Os03g25650.1	intron_variant ; MODIFIER	silent_mutation	Average:42.664; most accessible tissue: Callus, score: 69.662	N	N	N	N
vg0314687749	T -> DEL	N	N	silent_mutation	Average:42.664; most accessible tissue: Callus, score: 69.662	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0314687749	NA	1.84E-07	mr1193	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314687749	NA	1.82E-08	mr1354	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314687749	NA	2.22E-06	mr1408	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314687749	NA	4.06E-06	mr1437	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314687749	9.20E-08	4.52E-41	mr1542	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314687749	NA	4.43E-17	mr1542	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314687749	NA	2.75E-06	mr1620	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314687749	NA	8.22E-08	mr1690	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314687749	NA	4.91E-06	mr1821	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314687749	NA	5.18E-06	mr1895	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314687749	NA	1.57E-06	mr1913	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314687749	2.32E-06	2.32E-06	mr1955	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314687749	NA	1.29E-07	mr1187_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314687749	NA	3.34E-07	mr1212_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314687749	NA	7.40E-06	mr1326_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314687749	NA	2.80E-06	mr1354_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314687749	5.08E-06	NA	mr1542_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314687749	NA	1.62E-16	mr1542_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314687749	NA	2.49E-06	mr1552_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251