\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314687749:

Variant ID: vg0314687749 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 14687749
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


AATTTTAAGGTAATTGGATGTAAACTGTATATGCAATATAATTACTAAAGATTAAATTTAATATCTAAGGTAATATCTGTAGGATTGCTATGTAATGGCA[T/C]
TATTGATATCGGGAAAAAAACTCACCTAGCATATGCCTAGCCAAATTGATGCACCAAAATACAAATTGTCAAGTTCTTGTAGTAGAACGCACCTACCTGT

Reverse complement sequence

ACAGGTAGGTGCGTTCTACTACAAGAACTTGACAATTTGTATTTTGGTGCATCAATTTGGCTAGGCATATGCTAGGTGAGTTTTTTTCCCGATATCAATA[A/G]
TGCCATTACATAGCAATCCTACAGATATTACCTTAGATATTAAATTTAATCTTTAGTAATTATATTGCATATACAGTTTACATCCAATTACCTTAAAATT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.00% 0.20% 0.57% 25.26% NA
All Indica  2759 66.40% 0.00% 0.58% 32.98% NA
All Japonica  1512 98.90% 0.00% 0.00% 1.06% NA
Aus  269 3.70% 3.30% 4.09% 88.85% NA
Indica I  595 64.40% 0.00% 0.84% 34.79% NA
Indica II  465 31.40% 0.00% 0.65% 67.96% NA
Indica III  913 88.20% 0.00% 0.33% 11.50% NA
Indica Intermediate  786 63.50% 0.00% 0.64% 35.88% NA
Temperate Japonica  767 99.70% 0.00% 0.00% 0.26% NA
Tropical Japonica  504 97.80% 0.00% 0.00% 2.18% NA
Japonica Intermediate  241 98.80% 0.00% 0.00% 1.24% NA
VI/Aromatic  96 92.70% 0.00% 0.00% 7.29% NA
Intermediate  90 75.60% 0.00% 0.00% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0314687749 T -> C LOC_Os03g25660.1 downstream_gene_variant ; 2607.0bp to feature; MODIFIER silent_mutation Average:42.664; most accessible tissue: Callus, score: 69.662 N N N N
vg0314687749 T -> C LOC_Os03g25650.1 intron_variant ; MODIFIER silent_mutation Average:42.664; most accessible tissue: Callus, score: 69.662 N N N N
vg0314687749 T -> DEL N N silent_mutation Average:42.664; most accessible tissue: Callus, score: 69.662 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0314687749 NA 1.84E-07 mr1193 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314687749 NA 1.82E-08 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314687749 NA 2.22E-06 mr1408 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314687749 NA 4.06E-06 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314687749 9.20E-08 4.52E-41 mr1542 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314687749 NA 4.43E-17 mr1542 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314687749 NA 2.75E-06 mr1620 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314687749 NA 8.22E-08 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314687749 NA 4.91E-06 mr1821 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314687749 NA 5.18E-06 mr1895 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314687749 NA 1.57E-06 mr1913 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314687749 2.32E-06 2.32E-06 mr1955 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314687749 NA 1.29E-07 mr1187_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314687749 NA 3.34E-07 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314687749 NA 7.40E-06 mr1326_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314687749 NA 2.80E-06 mr1354_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314687749 5.08E-06 NA mr1542_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314687749 NA 1.62E-16 mr1542_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314687749 NA 2.49E-06 mr1552_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251