RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0314648455:

Variant ID: vg0314648455 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 14648455
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGTTAGTGATGACTTTCCTAAATTTTTTTCTCAAAACATCACATCAATTGAATCTTGAAGACGAATCTTTTGAGTCTAATTAGTCCATAATTAGCCATAA[G/A]
TACTACAGTAACCCATATATACTAATGACGGATTAATTAGGCTTAATAAATTTGTCTCGCGGTTTCTAGGCAAGTTATGAAATTAGTTTTTTCATTCGTA

Reverse complement sequence

TACGAATGAAAAAACTAATTTCATAACTTGCCTAGAAACCGCGAGACAAATTTATTAAGCCTAATTAATCCGTCATTAGTATATATGGGTTACTGTAGTA[C/T]
TTATGGCTAATTATGGACTAATTAGACTCAAAAGATTCGTCTTCAAGATTCAATTGATGTGATGTTTTGAGAAAAAAATTTAGGAAAGTCATCACTAACT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.40%	12.40%	2.16%	0.00%	NA
All Indica	2759	99.80%	0.00%	0.22%	0.00%	NA
All Japonica	1512	55.40%	38.20%	6.35%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.70%	0.00%	0.34%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.50%	0.00%	0.51%	0.00%	NA
Temperate Japonica	767	20.60%	67.90%	11.47%	0.00%	NA
Tropical Japonica	504	93.50%	6.00%	0.60%	0.00%	NA
Japonica Intermediate	241	86.70%	11.20%	2.07%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	92.20%	7.80%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0314648455	G -> A	LOC_Os03g25590.1	upstream_gene_variant ; 1499.0bp to feature; MODIFIER	silent_mutation	Average:65.149; most accessible tissue: Callus, score: 89.529	N	N	N	N
vg0314648455	G -> A	LOC_Os03g25590-LOC_Os03g25600	intergenic_region ; MODIFIER	silent_mutation	Average:65.149; most accessible tissue: Callus, score: 89.529	N	N	N	N

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0314648455	NA	1.00E-13	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0314648455	NA	4.26E-17	Spikelet_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0314648455	NA	7.22E-14	Spikelet_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0314648455	NA	4.26E-06	mr1044	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314648455	NA	1.65E-08	mr1045	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314648455	NA	1.85E-07	mr1045	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314648455	NA	2.66E-24	mr1115	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314648455	NA	4.97E-30	mr1137	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314648455	NA	6.41E-09	mr1137	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314648455	NA	2.04E-07	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 67 entries

Previous1 2 3 4 5 6 7Next

Search for Variation information by Variation ID:

Detailed information for vg0314648455:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact