Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314626927:

Variant ID: vg0314626927 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 14626927
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.96, A: 0.04, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

GAAGATTGTGGAGGAGGCCCGGCGCCGGTTTGTGAGTGGTTTGGAGTTCACCACCTTTGAAGTCAAGGAAGAACTACCCTAGTGATCGAGGCTTGGGTAG[T/A]
CCTCTCCATGGGCCGGCTCCCGCCTTGCCCACCCCTTGACGAAGGGGGCGTGCGGTGGCTTCGTGGTTGAGCGGTGGAGTTGGGCTCGCCTCAATGGGGA

Reverse complement sequence

TCCCCATTGAGGCGAGCCCAACTCCACCGCTCAACCACGAAGCCACCGCACGCCCCCTTCGTCAAGGGGTGGGCAAGGCGGGAGCCGGCCCATGGAGAGG[A/T]
CTACCCAAGCCTCGATCACTAGGGTAGTTCTTCCTTGACTTCAAAGGTGGTGAACTCCAAACCACTCACAAACCGGCGCCGGGCCTCCTCCACAATCTTC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.50%	22.40%	2.14%	0.00%	NA
All Indica	2759	68.30%	29.00%	2.68%	0.00%	NA
All Japonica	1512	99.10%	0.90%	0.00%	0.00%	NA
Aus	269	10.40%	80.30%	9.29%	0.00%	NA
Indica I	595	63.50%	34.10%	2.35%	0.00%	NA
Indica II	465	34.40%	60.40%	5.16%	0.00%	NA
Indica III	913	91.30%	7.40%	1.20%	0.00%	NA
Indica Intermediate	786	65.30%	31.60%	3.18%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	98.00%	2.00%	0.00%	0.00%	NA
Japonica Intermediate	241	98.80%	1.20%	0.00%	0.00%	NA
VI/Aromatic	96	93.80%	6.20%	0.00%	0.00%	NA
Intermediate	90	74.40%	23.30%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0314626927	T -> A	LOC_Os03g25570.1	upstream_gene_variant ; 486.0bp to feature; MODIFIER	silent_mutation	Average:43.078; most accessible tissue: Zhenshan97 flower, score: 56.847	N	N	N	N
vg0314626927	T -> A	LOC_Os03g25560-LOC_Os03g25570	intergenic_region ; MODIFIER	silent_mutation	Average:43.078; most accessible tissue: Zhenshan97 flower, score: 56.847	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0314626927	1.95E-12	1.40E-46	mr1542	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314626927	2.02E-10	4.38E-22	mr1542	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314626927	NA	3.28E-07	mr1155_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314626927	4.25E-06	NA	mr1227_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314626927	7.77E-06	5.18E-07	mr1227_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314626927	NA	5.37E-06	mr1246_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314626927	1.90E-10	4.59E-49	mr1542_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314626927	4.92E-09	6.84E-24	mr1542_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314626927	NA	3.32E-16	mr1587_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314626927	NA	7.27E-08	mr1587_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251