\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314626927:

Variant ID: vg0314626927 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 14626927
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.96, A: 0.04, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


GAAGATTGTGGAGGAGGCCCGGCGCCGGTTTGTGAGTGGTTTGGAGTTCACCACCTTTGAAGTCAAGGAAGAACTACCCTAGTGATCGAGGCTTGGGTAG[T/A]
CCTCTCCATGGGCCGGCTCCCGCCTTGCCCACCCCTTGACGAAGGGGGCGTGCGGTGGCTTCGTGGTTGAGCGGTGGAGTTGGGCTCGCCTCAATGGGGA

Reverse complement sequence

TCCCCATTGAGGCGAGCCCAACTCCACCGCTCAACCACGAAGCCACCGCACGCCCCCTTCGTCAAGGGGTGGGCAAGGCGGGAGCCGGCCCATGGAGAGG[A/T]
CTACCCAAGCCTCGATCACTAGGGTAGTTCTTCCTTGACTTCAAAGGTGGTGAACTCCAAACCACTCACAAACCGGCGCCGGGCCTCCTCCACAATCTTC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.50% 22.40% 2.14% 0.00% NA
All Indica  2759 68.30% 29.00% 2.68% 0.00% NA
All Japonica  1512 99.10% 0.90% 0.00% 0.00% NA
Aus  269 10.40% 80.30% 9.29% 0.00% NA
Indica I  595 63.50% 34.10% 2.35% 0.00% NA
Indica II  465 34.40% 60.40% 5.16% 0.00% NA
Indica III  913 91.30% 7.40% 1.20% 0.00% NA
Indica Intermediate  786 65.30% 31.60% 3.18% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 98.00% 2.00% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 74.40% 23.30% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0314626927 T -> A LOC_Os03g25570.1 upstream_gene_variant ; 486.0bp to feature; MODIFIER silent_mutation Average:43.078; most accessible tissue: Zhenshan97 flower, score: 56.847 N N N N
vg0314626927 T -> A LOC_Os03g25560-LOC_Os03g25570 intergenic_region ; MODIFIER silent_mutation Average:43.078; most accessible tissue: Zhenshan97 flower, score: 56.847 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0314626927 1.95E-12 1.40E-46 mr1542 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314626927 2.02E-10 4.38E-22 mr1542 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314626927 NA 3.28E-07 mr1155_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314626927 4.25E-06 NA mr1227_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314626927 7.77E-06 5.18E-07 mr1227_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314626927 NA 5.37E-06 mr1246_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314626927 1.90E-10 4.59E-49 mr1542_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314626927 4.92E-09 6.84E-24 mr1542_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314626927 NA 3.32E-16 mr1587_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314626927 NA 7.27E-08 mr1587_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251